RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1279
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0707100; Gene model (P.falciparum): PF3D7_0823500; Gene product: inner membrane complex protein 1i, putative (IMC1i)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 11 June 2015, 20:39
  *RMgm-1279
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26018192
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherKaneko I; Yuda M
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University Graduate School of Medicine
CityTsu, Mie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-1279
Principal nameIMC1i(–)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteThe mutants developed into ookinetes with normal conversion rates; however, nearly all of them (99.8%) displayed abnormal morphologies (only round forms)
OocystStrongly reduced oocyst production.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of IMC1i (inner membrane complex protein 1i, putative)

Protein (function)
The three motile and invasive stages (zoites) of Plasmodium species (i.e. ookinetes, sporozoites and merozoites), as well as zoites of other apicomplexan parasites, possess a similar cortical structure termed the pellicle. The pellicle is essentially made up of the plasma membrane and an underlying double membrane structure termed the inner membrane complex (IMC). Closely associated with the IMC on its cytoplasmic side is a network of intermediate filaments termed the subpellicular network (SPN), which supports the pellicular membranes and provides mechanical strength to the cell. Several members of an Apicomplexa-specific family of proteins termed IMC1 proteins have been identified as components of the SPN. Structurally related proteins from ciliates and dinoflagellate algae have since been added to this protein family renamed ‘alveolins’, which now defines the Alveolata infrakingdom. In the genus Plasmodium, the number of members of the alveolin family has risen to 12, which are encoded by conserved and syntenic genes. The alveolin family members display differential expression between the three zoite stages of the parasite, with the largest repertoires present in the ookinete and sporozoite according to proteomic studies. It has been shown in the rodent malaria species Plasmodium berghei that the disruption of individual alveolin family members expressed in sporozoites (PbIMC1a), in ookinetes (PbIMC1b) or in both these zoites (PbIMC1h) results in morphological abnormalities that are accompanied by reduced tensile strength of the zoite stages in which they are expressed. Besides roles in morphogenesis and mechanical strength, the Plasmodium alveolins are also involved in gliding motility in both ookinetes and sporozoites, most likely through interactions with components of the glideosome that are situated within the pellicular cytoplasm.

Phenotype
The successful knock-out of imc1d indicates it has no essential role during blood stage development/multiplication. The mutants developed into ookinetes with normal conversion rates; however, nearly all of them (99.8%) displayed abnormal morphologies (only round forms). Strongly reduced oocyst production.

Additional information

Other mutants
Click on IMC1 for other gene-deletion/tagging mutants targeting IMC1 proteins


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0707100
Gene Model P. falciparum ortholog PF3D7_0823500
Gene productinner membrane complex protein 1i, putative
Gene product: Alternative nameIMC1i
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TATGCCTGAATAAAATTATGGCATTCC
Additional information primer 1CTCATCTACAAGCATCgtcgacTGGCACGTTAGAAGGATTTGG
Sequence Primer 2CCTTCAATTTCGgatccactagATGAAGATGCTCGTTATGATG
Additional information primer 2CCTTCAATTTCGgatccactagATGAAGATGCTCGTTATGATG
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6