RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-1278
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_0302300; Gene model (P.falciparum): PF3D7_0204500; Gene product: aspartate transaminase | aspartate aminotransferase (aspartate aminotransferase; AspAT)
PhenotypeNo phenotype has been described
Last modified: 9 June 2015, 18:31
  *RMgm-1278
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 4
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26042734
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
top of page
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherSrivastava A; Waters AP
Name Group/DepartmentWellcome Trust Centre for Molecular Parasitology, Institute of Infection, Immunity and Inflammation
Name InstituteUniversity of Glasgow
CityGlasgow
CountryUK
  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0302300
Gene Model P. falciparum ortholog PF3D7_0204500
Gene productaspartate transaminase | aspartate aminotransferase
Gene product: Alternative nameaspartate aminotransferase; AspAT
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationAspartate aminotransferases catalyse the conversion of aspartate and alpha-ketoglutarate to oxaloacetate and glutamate in a reversible manner. Thus, the aspartate aminotransferase of Plasmodium falciparum (PfAspAT) plays a central role in the transamination of amino acids. Evidence has been presented that PfAspAT may also play a pivotal role in energy metabolism and the de novo biosynthesis of pyrimidines.

The unsuccessful attempts to disrupt this gene indicate an essential function during asexual blood stage growth
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GU2486 GTTTAATATGTTTGTGTGGAGGCTAAACCATATTC
Additional information primer 1GU2487 GAAATTGAATTTCGATAATGTATAATCGTTGCCTTTTG
Sequence Primer 2GU2488 CTTATTTGTTAGCGGTATTTATTTCAGCAGCAG
Additional information primer 2GU2489 CTTTTATGCGTTCAGAAAGCAAAGAGAGAAAC
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren