RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1271
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1017900; Gene model (P.falciparum): PF3D7_1426700; Gene product: phosphoenolpyruvate carboxylase (PEPC)
Transgene
Transgene not Plasmodium: RFP
Promoter: Gene model: PBANKA_1319500; Gene model (P.falciparum): PF3D7_1455800; Gene product: LCCL domain-containing protein (LAP4; LCCL/lectin adhesive-like protein 4; CCp2)
3'UTR: Gene model: PBANKA_1359600; Gene product: transmission blocking target antigen precursor 6-cysteine protein (P48/45)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Transgene
Transgene not Plasmodium: GFP (gfp-mut3)
Promoter: Gene model: PBANKA_0416100; Gene model (P.falciparum): PF3D7_0905300; Gene product: dynein heavy chain, putative
3'UTR: Gene model: PBANKA_1010600; Gene product: calmodulin, putative (cam)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 9 June 2015, 18:05
  *RMgm-1271
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 26042734
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 820cl1m1cl1 (RMgm-164)
Other information parent lineP. berghei ANKA 820cl1m1cl1 (RMgm-164) is a reference ANKA mutant line which expresses GFP under control of a male and RFP under control of a female gametocyte specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 19438517).
The mutant parasite was generated by
Name PI/ResearcherSrivastava A; Waters AP
Name Group/DepartmentWellcome Trust Centre for Molecular Parasitology, Institute of Infection, Immunity and Inflammation
Name InstituteUniversity of Glasgow
CityGlasgow
CountryUK
Name of the mutant parasite
RMgm numberRMgm-1271
Principal nameG881cl1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageReduced growth/multiplication of asexual blood stages
Gametocyte/GameteReduced gametocyte production
Fertilization and ookineteStrongly reduced ookinete formation
OocystStrongly reduced oocyst formation
SporozoiteNo sporozoite formation
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Phosphoenolpyruvate carboxylase (PEPC) and expresses GFP under control of a male and RFP under control of a female gametocyte specific promoter..

Protein (function)
Phosphoenolpyruvate carboxylase (PEPC) is involved in carbon metabolism. Carbon dioxide (CO2) is thought to be essential for the growth of intraerythrocytic malaria parasites in order to synthesize pyrimidine through CO2 fixation and to regulate the intracellular pH of the parasite. PEPC is thought to catalyse CO2 fixation with phosphoeno/pyruvate in the absence of pyruvate carboxylase in Plasmodium and thereby supplying the cytosol with oxaloacetate (OAA) [34]. P. falciparum mutants lacking expression of PEPC showed a strong reduction in growth of trophozoites and mutants could only be selected by supplying additional malate to cultures of the blood stages (Storm, J and Müller, S, 2010. Malaria Journal 9 (Suppl 2): P49).

Phenotype
Phenotype analyses indicate that PEPC is not essential for blood stage development, both for asexual stages and for gametocytes.

(Strongly) reduced gametocyte-, ookinete- and oocyst production. No formation of sporozoites.

Additional information
The growth of the pepc- mutant was compromised compared to wild type parasites, as the pepc- mutant, but not the mdh- mutant was overgrown by the wt parasite in an in vivo sensitive single host competitive growth assay. The number of merozoites observed in mature schizont stages was similar to wt.  Scrutiny of the growth phenotype detected in the pepc- mutants showed that they have a prolonged asexual cycle (4 h longer than wt). The number of gametocytes formed in blood stages was  reduced in pepc- mutants by almost 50% with no notable difference in male to female ratio. Further phenotypic analyses showed reduction of exflagellation (pepc- mutants 84% less than wt. Ookinete development in in vitro cultures of pepc- mutants was also severely affected.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1017900
Gene Model P. falciparum ortholog PF3D7_1426700
Gene productphosphoenolpyruvate carboxylase
Gene product: Alternative namePEPC
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GU2190 CCTTTTCCTTTTGTTTTATCCATCCATTTA
Additional information primer 1GU2191 AATCTCAAATTGTGAAATAAACAATAAAAAATTTTGTC
Sequence Primer 2GU2192 CTGAGTTCTGTATTTACTTTCATAAGTTTTTAAACG
Additional information primer 2GU2193 CCCACATAAGTAAATATACATACACATATTATTATGC
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameRFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modificationThe GFP gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1319500
Gene Model P. falciparum ortholog PF3D7_1455800
Gene productLCCL domain-containing protein
Gene product: Alternative nameLAP4; LCCL/lectin adhesive-like protein 4; CCp2
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_1359600
Gene producttransmission blocking target antigen precursor 6-cysteine protein
Gene product: Alternative nameP48/45
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mut3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0416100
Gene Model P. falciparum ortholog PF3D7_0905300
Gene productdynein heavy chain, putative
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_1010600
Gene productcalmodulin, putative
Gene product: Alternative namecam
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4