Back to search resultsSummaryRMgm-1247
|
||||||||||||
*RMgm-1247| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging, Gene tagging, Introduction of a transgene |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 27851824 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | RMgm-1281 |
| Other information parent line | A transgenic line expressing a mCherry-tagged version of PBANKA_1400300 (PIR protein; PIR1) and expressing the fusion protein GFP-luciferase under the control of the ama1 promoter |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | A. Fougère, C.J. Janse, B.M.D. Franke-Fayard |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1247 |
| Principal name | 2020; 2021 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | No |
| top of page | |
| Phenotype | |
| Asexual blood stage | The two tagged-protein are exported into the cytoplasm of the host erythrocyte and show a diffuse or patchy localization in the cytoplasm. 1-5% of blood stages expressed both proteins simultaneously in a single infected erythrocyte |
| Gametocyte/Gamete | Not tested |
| Fertilization and ookinete | Not tested |
| Oocyst | Not different from wild type |
| Sporozoite | Not different from wild type |
| Liver stage | PIR1 is expressed in late liver stages (schizonts) where it is located in the parasitophorous vacuole. |
| Additional remarks phenotype | Mutant/mutation The mutant parasite expresses mCherry-tagged PBANKA_1400300 (PIR1), GFP-tagged PBANKA_0500200 (PIR3) and expresses the fusion protein GFP-luciferase under the control of the ama1 promoter The proteins have been selected for tagging in a screen for putative exported proteins of P. berghei. The genotype of the parasites has not been analysed in detail. Southern analysis of PFG-separated chromosomes (to show integration into the chromosome on which the target gene is located) has been performed (see below). This analysis provided evidence for tagging of the correct genes. The construct used aims at integration of the tagging construct by single-cross-over integration resulting in the presence of a tagged copy of the endogenous gene. Phenotype of different life cycle stages show:
|
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1400300 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||||
| Gene product | PIR protein; BIR protein | ||||||||||||||||||||||||||
| Gene product: Alternative name | PIR1 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | mCherry | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | Clontech | ||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTC
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | PmeI | ||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The pir3::gfp DNA construct was introduced in mutant RMgm-1281 that contains a mCherry-tagged version of pir1 and gfp-luciferase in the 230p locus (under the control of the ama1 promoter) | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0500200 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||||
| Gene product | BIR protein; PIR protein | ||||||||||||||||||||||||||
| Gene product: Alternative name | PIR3 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | EGFP | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AGCTTGGGCCCCCGCGGATCGATAGATCTGTTAACAGGCCTCTGCAGCCCAGCTTAATTC
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | BsiWI | ||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
| Selection (positive) procedure | WR99210 | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The pir3::gfp DNA construct was introduced in mutant RMgm-1281 that contains a mCherry-tagged version of pir1 and gfp-luciferase in the 230p locus (under the control of the ama1 promoter) | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||
| Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
| Promoter of the selectable marker | ama-1 | ||||||||||||||||||
| Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | The GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration. | ||||||||||||||||||
| Additional remarks selection procedure | This reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence. | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0915000 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1133400 | ||||||||||||||||||
| Gene product | apical membrane antigen 1 | ||||||||||||||||||
| Gene product: Alternative name | ama-1 | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
| Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Replacement locus | ||||||||||||||||||
| Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||
| Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||