Back to search resultsSummaryRMgm-1244
|
||||||||||
*RMgm-1244| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging, Gene tagging |
| Reference (PubMed-PMID number) | Not published (yet) |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | RMgm-693 |
| Other information parent line | A transgenic parasite line expressing a mCherry-tagged version of PBANKA_1327300 (fam-a protein; fam-a2) |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | A. Fougère, C.J. Janse, B.M.D. Franke-Fayard |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1244 |
| Principal name | 2010; 2011 |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | No |
| top of page | |
| Phenotype | |
| Asexual blood stage | The two tagged-proteins are exported into the host erythrocyte. Fam-a2 shows a diffuse or patchy localization in the cytoplasm, whereas Fam-a1 is located at the erythrocyte surface membrane. 40-55% of blood stages expressed both proteins simultaneously in a single infected erythrocyte |
| Gametocyte/Gamete | Both proteins are expressed in a similar pattern as in asexual blood stages |
| Fertilization and ookinete | Not tested |
| Oocyst | Not different from wild type |
| Sporozoite | Not different from wild type |
| Liver stage | Fam-a2 is expressed in late liver stages (schizonts) where it is located in the parasitophorous vacuole. More than 90% of liver stages expressed the protein. Fam-a1 was not expressed in liver stages (but see RMgm-690 and RMgm-1245 where Fam-a1 was detected in liver stages) |
| Additional remarks phenotype | Mutant/mutation The mutant parasite expresses mCherry-tagged PBANKA_1327300 (Fam-a2) and GFP-tagged PBANKA_0836800 (Fam-a1). The proteins have been selected for tagging in a screen for putative exported proteins of P. berghei. The genotype of the parasites has not been analysed in detail. Southern analysis of PFG-separated chromosomes (to show integration into the chromosome on which the target gene is located) has been performed (see below). This analysis provided evidence for tagging of the correct genes. The construct used aims at integration of the tagging construct by single-cross-over integration resulting in the presence of a tagged copy of the endogenous gene. Phenotype of different life cycle stages show:
|
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1327300 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||||
| Gene product | fam-a protein | ||||||||||||||||||||||||||
| Gene product: Alternative name | fam-a2 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | mCherry | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | Clontech | ||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AACATATTATGGGACCCCAATGGCGCAAAGAACTTCGATGATAAATTTATTAAAGGTATA
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | HpaI | ||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The fam-a1::gfp DNA construct was introduced in mutant RMgm-693 that contains a mCherry-tagged version of fam-a2 | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0836800 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||||||||||
| Gene product | erythrocyte membrane associated protein 1; fam-a protein | ||||||||||||||||||||||||||
| Gene product: Alternative name | EMAP1; fam-a1 | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | GFP | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AGCTTGGGCCCCCGCGGATCGATAGATCTGTTAACAGGCCTCTGCAGCCCAGCTTAATTC
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | NdeI | ||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||||
| Selection (positive) procedure | WR99210 | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | The fam-a1::gfp DNA construct was introduced in mutant RMgm-693 that contains a mCherry-tagged version of fam-a2 | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||