SummaryRMgm-1161
|
||||||||||
*RMgm-1161| Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
| The following genetic modifications were attempted | Gene disruption |
| Number of attempts to introduce the genetic modification | 3 |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 26991313 |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 676m1cl1 (RMgm-29) |
| Other information parent line | 676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
| top of page | |
| Attempts to generate the mutant parasite were performed by | |
| Name PI/Researcher | Rijpma SR, Janse CJ, Franke-Fayard BM |
| Name Group/Department | Leiden Malaria Research Group |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0608300 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1209900 | ||||||||||||||||||||||||
| Gene product | ABC transporter B family member 7, putative | ||||||||||||||||||||||||
| Gene product: Alternative name | MDR7 (multidrug resistance protein 7); ABCB7 | ||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() AGCTTGCATGCCTGCAGGTCAACAATAAATAATAAATAAATATTGTGGAAATAAAATAAC
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||
| Additional remarks genetic modification | Three unsuccessful transfection experiments using DNA construct pL1629 (exp. 1665, 2103, 1728). The unsuccessful attempts to delete the gene indicate an essential role during blood stage growth/multiplication. In different Plasmodium parasites 14-16 ABC-transporter genes have been identified (16 in P. falciparum, 14 in P. berghei). Based on phylogenetic analysis of the conserved nucleotide-binding domains, seven of these are recognized as members of the B family of ABC transporters (both in P. falciparum and in P. berghei). This includes MDR7 (multidrug resistance protein 7). | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||