Back to search resultsSummaryRMgm-1148
|
||||||||||
*RMgm-1148| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation, Introduction of a transgene |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25438048 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
| Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Ferguson, DJP; Sinnis, P; Tewaria R |
| Name Group/Department | Centre for Genetics and Genomics |
| Name Institute | School of Life Sciences, Queens Medical Centre, University of Nottingham |
| City | Nottingham |
| Country | UK |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1148 |
| Principal name | ΔRep |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Normal numbers of oocysts. sporozoite development inside oocysts at days 13–14 post-infection was normal. In wild type parasites typically an increase in the number of midgut sporozoites is observed between days 14 and 18 post-infective blood meal as sporogony proceeds. At approximately day 16, mature sporozoites begin to exit the oocyst and enter the hemocoel, leading to a decrease in midgut sporozoite numbers. Although ΔRep parasites looked normal at day 14, the sporozoite numbers did not increase as time went on. ΔRep parasites looked normal at day 14, the sporozoite numbers did not increase as time went on. To determine whether this was a defect in sporozoite development or whether sporogony occurred in fewer oocysts, the number of sporozoites per oocyst was compared in ΔRep and control parasites. The initial number of sporozoites per oocyst in control and ΔRep parasites is comparable, however at later time points the number of sporozoites per oocyst increases in the control parasites, but not in ΔRep parasites, suggesting that although sporogony begins in a canonical fashion in the DRep mutant, it does not proceed normally. Observation of oocysts of the DRep mutant by phase-microscopy suggests that they were degenerating. Nonetheless, at day 21, morphologically normal sporozoites could be isolated from ΔRep-infected midguts by homogenization.although at significantly lower numbers compared to controls. Although low numbers of ΔRep oocyst sporozoites were observed, ΔRep sporozoites were never detected in the hemolymph or in salivary glands. |
| Sporozoite | Aberrant sporozoite formation inside oocysts. Although low numbers of ΔRep oocyst sporozoites were observed, ΔRep sporozoites were never detected in the hemolymph or in salivary glands. |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Its overall structure is highly conserved in all Plasmodium species, consisting of a central repeat region flanked by an NH2-terminal domain containing a conserved proteolytic cleavage site, and a COOH-terminal celladhesion domain, the thrombospondin repeat (TSR). Deletion of the csp gene gives rise to oocysts in which sporozoites do not develop, demonstrating a critical role for this protein in sporozoite development. Various studies have dissected the functional role of the NH2 and COOH-terminal regions during egress from oocysts, invasion of salivary glands, exit from the inoculation site and localization to and invasion of hepatocytes. After their release from oocysts, the NH2-terminus of CSP mediates adhesion to salivary glands and in the mammalian host, it masks the TSR, maintaining the sporozoite in a migratory state. Once in the liver, a regulated proteolytic cleavage event leads to the removal of the NH2-terminal third of the protein exposing the TSR an event that is critical for efficient invasion of hepatocytes by sporozoites. See the link PBANKA_040320 for other CSP related mutants |
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0403200 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_0304600 | ||||||||||||||||||||||||||
| Gene product | circumsporozoite (CS) protein | ||||||||||||||||||||||||||
| Gene product: Alternative name | CS; CSP | ||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | The endogenous cs gene with a cs gene lacking the repeat region | ||||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | To generate a Drep gene without the central repeat region, the sequences encoding the NH2-terminal and COOH-terminal fragments of CSP were amplified with overlapping primers and engineered restriction sites to join the two fragments. First a ,1.6 kb NH2-terminal fragment of the csp containing the 59UTR region (starting at 1276 bp downstream of the gene) and covering the NH2-terminal region of the protein (up to Region I, 92 aa) was amplified with primers PbCS-N1 (GGCCCGCGG GGTACCAAATATTATATG) and PbCS-N2 (GGCCCACCTGGCTGG*GG TTGTTTCAATTTATT) with SacII and BstXI restriction sites respectively; the BstXI site was designed by introduction of a silent mutation so that it overlapped sequences encoding the NH2-terminus of the COOH-terminal protein fragment. The restriction sites in the primers are shown in italics and the overlapping region of the two fragments are underlined; the silent mutation introduced in the reverse primer (PbCS-N2) is marked with asterisk. The 3' fragment (,0.6 kb) of the gene containing the 3'UTR region (up to 299 bp downstream of the gene) with COOH-terminal region (containing TSR, 245–347 aa) was amplified with primers PbCS-C1 (CAACCC*CA GCCAGGTGGTAATAAC) and PbCS-C2 (GGCAAGCTT CGATATCGTCATAGCAAG) with BstXI and HindIII sites respectively. The two PCR amplified fragments were purified, digested with respective restriction enzymes and joined together by three-way ligation into the pPCR-Script SK(+) vector digested with SacII and HindIII restriction enzymes. The complete gene was sequenced for confirmation. The transfection plasmid was constructed for double homologous recombination to replace the native csp locus with a Drep variant with its control elements and a selection cassette. The transfection plasmid (pDrep) was built from pPfCSP construct previously described. Briefly, the construct contained a 59UTR of the P. berghei csp gene encompassing nucleotides 1–1130 immediately upstream of the P. berghei csp start codon. The mutated P. berghei csp Drep, lacking the repeat region, and the 39UTR region of P. berghei csp encompassing nucleotides 1–1150 downstream of its stop codon into which the DHFR-TS selectable marker cassette was inserted at its HindIII site (+302). The repeatless P. berghei csp gene (588 bp long) was amplified with primers PbRL-N (GGCGAATTCATGAAGAAGT GTACCATTTTAG) and PbRLC (GGCGGATCC TTAATTAAAGAATACTAATAC); the amplified fragment was digested with EcoRI and BamHI and cloned in the respective sites in the pPfCSP vector replacing the P. falciparum csp gene to generate the Δrep construct. Restriction enzymes ApaI and XbaI were used to release the linear transfection construct. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | GFP (gfp-mu3) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||
| Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||
| Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | The GFP gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration. | ||||||||||||||||||
| Additional remarks selection procedure | This reporter mutant expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence. | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
| Gene product | elongation factor 1-alpha | ||||||||||||||||||
| Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
| Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Replacement locus | ||||||||||||||||||
| Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||
| Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||