SummaryRMgm-1145
|
||||||||
*RMgm-1145| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene tagging |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25418785 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA cl15cy1 |
| Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Guerreiro A; Mair GR |
| Name Group/Department | Instituto de Medicina Molecular |
| Name Institute | Faculdade de Medicina da Universidade de Lisboa |
| City | Lisbon |
| Country | Portugal |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1145 |
| Principal name | 2183 |
| Alternative name | PBANKA_133470::GFP |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | No |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | mRNA present but absence of the GFP-tagged protein (translationally repressed) |
| Fertilization and ookinete | Expression of the GFP-tagged protein in developing zygotes/ookinetes. |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation In this study 5 (translationally repressed) genes were C-terminally tagged with GFP (PBANKA_082120, PBANKA_133470, PBANKA_111410, PBANKA_010770, PBANKA_072090. All genes are transcribed in gametocytes but expression of the GFP-tagged proteins only occurs after fertilization in the developing zygote/ookinete Other mutants |
Tagged: Mutant parasite with a tagged gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_1334700 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1471500 | ||||||||||||||||||||||||||
| Gene product | transmembrane protein 43, putative | ||||||||||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Name of the tag | GFP | ||||||||||||||||||||||||||
| Details of tagging | C-terminal | ||||||||||||||||||||||||||
| Additional remarks: tagging | |||||||||||||||||||||||||||
| Commercial source of tag-antibodies | |||||||||||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() ATTTCGATATCGGGGAATTGAATACTAATGTTTATGACAACTATTTGTATACAGGAGATC
| ||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | In situ C-terminal GFP-tagging was performed by single crossover homologous recombination into the corresponding locus using construct pLIS0084. The construct contain the tgdhfr/ts selectable marker under the control of P. berghei dhfr/ts 5′ and 3′ UTRs. Primers used to amplify the targeting regions corresponding to the 3′ end of the ORF excluding the stop codon are listed in Additional file 6: Table S4. Targeting regions were cloned upstream and in frame with the GFP. The plasmid was linearized and transfected into line cl15cy1. | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||