Back to search resultsSummaryRMgm-1140
|
||||||||||
*RMgm-1140| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene disruption, Introduction of a transgene |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25407681 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 676m1cl1 (RMgm-29) |
| Other information parent line | 676m1cl1 (RMgm-29) is a reference ANKA mutant line which expresses GFP-luciferase under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Schaijk B van; Janse CJ; Khan SM; Sauerwein RW |
| Name Group/Department | Leiden Malaria Research Group, Department of Parasitology |
| Name Institute | Leiden University Medical Center (LUMC) |
| City | Leiden |
| Country | The Netherlands |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1140 |
| Principal name | PbΔslarp |
| Alternative name | 1839cl3 |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Not different from wild type |
| Sporozoite | Not different from wild type |
| Liver stage | Normal numbers of motile sporozoites are formed. Sporozoites show normal traversal and invasion of hepatocytes in vitro. Development of liver stages is completely aborted soon after invasion of sporozoites. Intravenous injection of up to 500.000 PbΔslarp sporozoites never led to full development of parasites in the liver as assayed by in vivo imaging of parasite liver loads or analysis of blood stage infection. |
| Additional remarks phenotype | Mutant/mutation |
Disrupted: Mutant parasite with a disrupted gene| top of page | |||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0902100 | ||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1147000 | ||||||||||||||||||||||||
| Gene product | sporozoite and liver stage asparagine-rich protein | sporozoite asparagine-rich protein | ||||||||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||||||||
| Type of plasmid/construct used | (Linear) PCR construct double cross-over | ||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
| Plasmid/construct map |
![]() | ||||||||||||||||||||||||
| Plasmid/construct sequence |
![]() ![]() GAACTCGTACTCCTTGGTGACGGGTACCGGGAGTCAAAAACGGTATGCAAAGCTAAATAA
| ||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||
| Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
| Additional remarks partial/complete disruption | |||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | hdhfr/yfcu | ||||||||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||||||||
| Selection (positive) procedure | No | ||||||||||||||||||||||||
| Selection (negative) procedure | 5-fluorocytosine (5-FC) | ||||||||||||||||||||||||
| Additional remarks genetic modification | The mutant was generated by disruption of the gene using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below). The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hDHFR selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction. The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hDHFR selectable marker cassette used in this reaction was digested from pL0040 using restriction enzymes XhoI and NotI. pL0040 is available from The Leiden Malaria Research Group. To remove the anchor-tags from the final KO construct, and to eliminate contaminating pL0040, the 2nd PCR product was digested with Asp718/ScaI and DpnI respectively. DpnI only cuts methylated plasmid DNA but not the PCR product. Using this PCR-based targeting construct (pL1740) the mutant PbΔslarp-a (1839cl3) was generated in the PbGFP-Luccon reference line using standard methods of transfection and positive selection with pyrimethamine. | ||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||
|
Primer information: Primers used for amplification of the target sequences
![]() Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||
| Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||
| Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | The GFP-Luciferase gene (1 copy) has been inserted into the 230p locus by double cross-over integration. | ||||||||||||||||||
| Additional remarks selection procedure | This reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence. | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
| Gene product | elongation factor 1-alpha | ||||||||||||||||||
| Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
| Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Replacement locus | ||||||||||||||||||
| Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||
| Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||