RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1125
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: OVA (AA 142-389) fused to export motifs
Promoter: Gene model: PBANKA_0501200; Gene model (P.falciparum): Not available; Gene product: early transcribed membrane protein up-regulated in infective sporozoites (UIS4; ETRAMP10.3)
3'UTR: Gene model: Not available; Gene product: Not available
Insertion locus: Gene model: Not available; Gene product: Not available (small subunit ribosomal rna gene (c- or d-type unit))
Transgene
Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Sporozoite; Liver stage;
Last modified: 12 September 2014, 19:54
  *RMgm-1125
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25073641
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherMontagna, GN; Matuschewski, K
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-1125
Principal nameexpOVA
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteOVA expression in sporozoites
Liver stageOVA expression in liver stages.
expOVA largely displayed a distinct pattern on structures outside the parasite. The exported OVA molecules were always surrounded by parasite membrane material, as shown by positive staining for UIS4, a specific marker of the parasitophorous vacuole membrane (PVM). No OVA signal was detected free in the host cell cytoplasm but inside vesicles, which are often detached from the PVM.
Additional remarks phenotype

Mutant/mutation
The mutant expresses a truncated version of OVA (ovalbumin), encompassing amino acids 142 to 389 and including the well-characterized CD8+ and CD4+ T-cell epitopes, which is fused to the CSP export sequence together with an N-terminal PEXEL motif . The OVA transgene is under control of the sporozoite/liver stage specific uis4 promoter.  In addition the mutant expresses GFP under the constitutive eefa promoter

Protein (function)

Phenotype
OVA expression in sporozoites and liver stages.
expOVA largely displayed a distinct pattern on structures outside the liver stage parasite. The exported OVA molecules were always surrounded by parasite membrane material, as shown by positive staining for UIS4, a specific marker of the parasitophorous vacuole membrane (PVM). No OVA signal was detected free in the host cell cytoplasm but inside vesicles, which are often detached from the PVM.

Additional information
By comparing this mutant and a similar mutant that express OVA in the cytoplasm (RMgm-1124) evidence is presented that:
Immunization with live attenuated transgenic sporozoites revealed that antigen export was not critical for CD8 T-cell priming but enhanced CD8 T-cell proliferation in the liver. Upon transfer of antigen-specific CD8 T cells, liver-stage parasites secreting the target protein were eliminated more efficiently.

Other mutants
RMgm-1124: A simular mutant expressing OVA that is expressed in the cytoplasm of liver stages.

Click on Ovalbumin for more rodent malaria mutants expressing OVA


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameOVA (AA 142-389) fused to export motifs
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTo generate P. berghei parasites expressing OVA, a 747-bp fragment of chicken OVA corresponding to amino acids 142 to 389 was amplified with primers OVA_sin and OVA-_rev, using an OVA-containing plasmid as the template. The UIS4 promoter was amplified from P. berghei genomic DNA using primers UIS4_5’UTR_fd and UIS4_5’UTR_UIS4_PEXEL_reverse. To amplify a 1.1-kb fragment of the P. berghei small subunit (ssU) rRNA locus, primers PbSSU_fd and ssU_rv were used, with P. berghei genomic DNA as the template. The resulting fragments were cloned into the P. berghei transfection vector B3D+, leading to plasmid pOVA-BD3+. For export of OVA, a 221-bp fragment from the PEXEL motif of CSP was amplified using the primers PEXEL_fd and PEXEL_rv. The corresponding OVA fragment was amplified using the primers OVA_fv2 and OVA-_rev. The resulting fragments were cloned into B3D+, generating plasmid pexpOVA-BD3+.

OVA_sin AAAAGCGGCCGCAAAAGGTAAAATGGCCAGAGAGCTCATCAAT NotI
OVA_rev a CGCGGATCCGCGCTATCTAGAAGGGGAAAC BamHI
UIS4_5’UTR_fd TTCCGCGGTTAATTATTATTATATCATGAAAGTAATG SacII
UIS4_PEXEL_reverse ATTTGCGGCCGCTTTATTTATTCAGACGTAATAATTATGTG NotI
PbSSU_fd CCCAAGCTTGGGCTGTAGCTAATACTTGTTAAG HindIII
ssU_rv a GGGGTACCCCGCCGCAAGCTCCACGCCTGGTG KpnI
PEXEL_fd AACCAAAAAAGCGGCCGCAAAAGGTAAAAATGAAGAAGTGTACCATTTTAG NotI
PEXEL_rv CGGACTAGTCCGATCGGCAAGTAATCTGTTGACTG SpeI
OVA_fv2 a CGGACTAGTCCGGCCAGAGAGCTCATCAAT SpeI
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0501200
Gene Model P. falciparum ortholog Not available
Gene productearly transcribed membrane protein up-regulated in infective sporozoites
Gene product: Alternative nameUIS4; ETRAMP10.3
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative namesmall subunit ribosomal rna gene (c- or d-type unit)
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4