Back to search resultsSummaryRMgm-1125
|
||||||||||
*RMgm-1125| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Introduction of a transgene, Introduction of a transgene |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 25073641 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
| Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Montagna, GN; Matuschewski, K |
| Name Group/Department | Parasitology Unit |
| Name Institute | Max Planck Institute for Infection Biology |
| City | Berlin |
| Country | Germany |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1125 |
| Principal name | expOVA |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | Not different from wild type |
| Gametocyte/Gamete | Not different from wild type |
| Fertilization and ookinete | Not different from wild type |
| Oocyst | Not different from wild type |
| Sporozoite | OVA expression in sporozoites |
| Liver stage | OVA expression in liver stages. expOVA largely displayed a distinct pattern on structures outside the parasite. The exported OVA molecules were always surrounded by parasite membrane material, as shown by positive staining for UIS4, a specific marker of the parasitophorous vacuole membrane (PVM). No OVA signal was detected free in the host cell cytoplasm but inside vesicles, which are often detached from the PVM. |
| Additional remarks phenotype | Mutant/mutation Other mutants |
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | OVA (AA 142-389) fused to export motifs | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||
| Selection (positive) procedure | pyrimethamine | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | To generate P. berghei parasites expressing OVA, a 747-bp fragment of chicken OVA corresponding to amino acids 142 to 389 was amplified with primers OVA_sin and OVA-_rev, using an OVA-containing plasmid as the template. The UIS4 promoter was amplified from P. berghei genomic DNA using primers UIS4_5’UTR_fd and UIS4_5’UTR_UIS4_PEXEL_reverse. To amplify a 1.1-kb fragment of the P. berghei small subunit (ssU) rRNA locus, primers PbSSU_fd and ssU_rv were used, with P. berghei genomic DNA as the template. The resulting fragments were cloned into the P. berghei transfection vector B3D+, leading to plasmid pOVA-BD3+. For export of OVA, a 221-bp fragment from the PEXEL motif of CSP was amplified using the primers PEXEL_fd and PEXEL_rv. The corresponding OVA fragment was amplified using the primers OVA_fv2 and OVA-_rev. The resulting fragments were cloned into B3D+, generating plasmid pexpOVA-BD3+. OVA_sin AAAAGCGGCCGCAAAAGGTAAAATGGCCAGAGAGCTCATCAAT NotI OVA_rev a CGCGGATCCGCGCTATCTAGAAGGGGAAAC BamHI UIS4_5’UTR_fd TTCCGCGGTTAATTATTATTATATCATGAAAGTAATG SacII UIS4_PEXEL_reverse ATTTGCGGCCGCTTTATTTATTCAGACGTAATAATTATGTG NotI PbSSU_fd CCCAAGCTTGGGCTGTAGCTAATACTTGTTAAG HindIII ssU_rv a GGGGTACCCCGCCGCAAGCTCCACGCCTGGTG KpnI PEXEL_fd AACCAAAAAAGCGGCCGCAAAAGGTAAAAATGAAGAAGTGTACCATTTTAG NotI PEXEL_rv CGGACTAGTCCGATCGGCAAGTAATCTGTTGACTG SpeI OVA_fv2 a CGGACTAGTCCGGCCAGAGAGCTCATCAAT SpeI | ||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0501200 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | Not available | ||||||||||||||||||
| Gene product | early transcribed membrane protein up-regulated in infective sporozoites | ||||||||||||||||||
| Gene product: Alternative name | UIS4; ETRAMP10.3 | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | Not available | ||||||||||||||||||
| Gene product | Not available | ||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Insertion locus | ||||||||||||||||||
| Gene Model of Parasite | Not available | ||||||||||||||||||
| Gene product | Not available | ||||||||||||||||||
| Gene product: Alternative name | small subunit ribosomal rna gene (c- or d-type unit) | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
Transgene: Mutant parasite expressing a transgene| top of page | |||||||||||||||||||
| Type and details of transgene | |||||||||||||||||||
| Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
| Transgene name | GFP (gfp-mu3) | ||||||||||||||||||
| top of page | |||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||
| Additional remarks inducable system | |||||||||||||||||||
| Type of plasmid/construct | (Linear) plasmid double cross-over | ||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||
| Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
| Promoter of the selectable marker | eef1a | ||||||||||||||||||
| Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||
| Additional remarks genetic modification | |||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Other details transgene | |||||||||||||||||||
| top of page | |||||||||||||||||||
| Promoter | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
| Gene product | elongation factor 1-alpha | ||||||||||||||||||
| Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||
| 3'-UTR | |||||||||||||||||||
| Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
| Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
| Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
| Insertion/Replacement locus | |||||||||||||||||||
| Replacement / Insertion | Replacement locus | ||||||||||||||||||
| Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
| Gene product | 6-cysteine protein | ||||||||||||||||||
| Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
| top of page | |||||||||||||||||||