RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-112
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1353400; Gene model (P.falciparum): PF3D7_1340000; Gene product: secreted ookinete protein, putative (PSOP7, Putative Secreted Ookinete Protein 7)
Name tag: c-myc
Phenotype Fertilization and ookinete;
Last modified: 19 February 2009, 21:10
  *RMgm-112
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom
top of page
Name of the mutant parasite
RMgm numberRMgm-112
Principal name∆psop7-myc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationNo
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteFertilization and ookinete formation is not different from wild type. IFA-analysis of ookinetes using c-myc antibodies showed expression of PSOP7-myc with an apical location in the ookinetes.
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant expresses a c-terminal myc-tagged form of PSOP7 (Putative Secreted Ookinete Protein 7).

Protein (function)
Phenotype analyses of mutants deficient in expressing of PSOP7 (RMgm-96) indicate a role during invasion/traversal of the ookinetes throug the midgut wall. The protein was detected in a proteome analysis of ookinetes and contains a predicted signal sequence and a CBM_5_12 (carbohydrate binding) domain.
 

Phenotype
IFA-analysis of ookinetes using c-myc antibodies showed expression of PSOP7-myc with an apical location in the ookinetes (which might be suggestive of a location in micronemes).

Additional information
The tagged protein PSOP7-myc migrates significantly faster in SDS-PAGE than its predicted molecular weight  and thus may undergo proteolytic processing. The mutant expressing tagged PSOP7 show normal mosquito infectivity, indicating that the myc-tagged protein is functional. 

Other mutants 
RMgm-96: a mutant deficient in expressin PSOP7.

  Tagged: Mutant parasite with a tagged gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1353400
Gene Model P. falciparum ortholog PF3D7_1340000
Gene productsecreted ookinete protein, putative
Gene product: Alternative namePSOP7, Putative Secreted Ookinete Protein 7
top of page
Details of the genetic modification
Name of the tagc-myc
Details of taggingC-terminal
Additional remarks: tagging3' 1499 bp immediately upstream of the stop codon cloned in frame with a tandem double c-myc tag
Commercial source of tag-antibodiesCell Signalling
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ClaI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCCGAATGCCATAAGTGATAATCAG
Additional information primer 1#7 c-myc F (KpnI),
Sequence Primer 2TTGGGCCCAAAATTGTAACAATCACTTGTTTTGTC
Additional information primer 2#7 c-myc R (ApaI),
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren