| top of page |
| Type and details of transgene |
| Is the transgene Plasmodium derived |
Transgene: not Plasmodium |
| Transgene name | Ovalbumin (OVA ) fused to mCherry |
| top of page |
| Details of the genetic modification |
| Inducable system used | No |
| Additional remarks inducable system |
|
| Type of plasmid/construct | (Linear) plasmid double cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | hdhfr/yfcu |
| Promoter of the selectable marker | eef1a |
| Selection (positive) procedure | No |
| Selection (negative) procedure | 5-fluorocytosine (5-FC) |
| Additional remarks genetic modification | The CDS (without stop codon) of OVA was PCR-amplified from plasmid pENTRY201-OVA using primers 6466/6467 (CCCGCTCGAGATGGGCTCCATCGGTGCAG and CCGCGGATCCAGGGGAAACACATCTGCC) and cloned into the sites XhoI/BamHI of pL1809, resulting in placement of OVA between the hsp70 promoter region and the mCherry CDS |
| Additional remarks selection procedure | This reporter mutant expressing OVA::mCherry does not contain a drug-selectable marker.
The mutant has been generated in the reference line GIMOPbANKA (RMgm-678). The GIMO mother line is used for introduction of transgenes into the modified 230p locus through transfection with constructs that target the 230p locus. These constructs insert into the 230p locus (‘gene insertion’), thereby removing the hdhfr::yfcu selectable marker (‘marker out’) from the genome of the mother lines. Transgenic parasites that are marker-free are subsequently selected by applying negative drug selection using 5-FC. This selection procedure is performed in vivo in mice. |
| top of page |
| Other details transgene |
| top of page |
| Promoter |
| Gene Model of Parasite |
PBANKA_0711900
|
| Gene Model P. falciparum ortholog |
PF3D7_0818900
|
| Gene product | heat shock protein 70 |
| Gene product: Alternative name | HSP70 |
Primer information details of the primers used for amplification of the promoter sequence 
Primer information details of the primers used for amplification of the promoter sequence
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| top of page |
| 3'-UTR |
| Gene Model of Parasite |
PBANKA_0711900
|
| Gene product | heat shock protein 70 |
| Gene product: Alternative name | HSP70 |
Primer information details of the primers used for amplification the 3'-UTR sequences 
Primer information details of the primers used for amplification the 3'-UTR sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
|
|
| Insertion/Replacement locus |
| Replacement / Insertion | Replacement locus |
| Gene Model of Parasite |
PBANKA_0306000
|
| Gene product | 6-cysteine protein |
| Gene product: Alternative name | 230p |
Primer information details of the primers used for amplification of the target sequences
Primer information details of the primers used for amplification of the target sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
| Sequence Primer 3 | |
| Additional information primer 3 | |
| Sequence Primer 4 | |
| Additional information primer 4 | |
|
|
| top of page |