RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1106

Malaria parasite	P. berghei
Genotype
Tagged	Gene model (rodent): PBANKA_0302500; Gene model (P.falciparum): PF3D7_0204700; Gene product: hexose transporter (hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1) Name tag: c-myc
Phenotype	Gametocyte/Gamete;

Last modified: 16 August 2014, 21:55

*RMgm-1106

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene tagging
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 25124718
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	P. berghei ANKA 2.34
Other information parent line	P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
top of page
The mutant parasite was generated by
Name PI/Researcher	Talman AM; Sinden RE
Name Group/Department	Division of Cell and Molecular Biology
Name Institute	Imperial College
City	London
Country	UK
top of page
Name of the mutant parasite
RMgm number	RMgm-1106
Principal name	pHTmyc
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not tested
Gametocyte/Gamete	By staining male gametes with cmyc-antibodies evidence is presented that the hexose transporter (HT) is located at the plasma membrane of male gametes.
Fertilization and ookinete	Not tested
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a C-terminal c-myc(2x)-tagged version of the hexose transporter (HT) Protein (function) PbHT1 is a facilitative hexose transporter in the Major Facilitator Superfamily of integral membrane proteins that mediates the uptake of glucose and fructose by the parasite. HT1 of P. falciparum is known to transport glucose and fructose and is essential for blood stage parasites. See also the mutants with search term 'hexose transporter'. Phenotype By staining male gametes with cmyc-antibodies evidence is presented that the hexose transporter (HT) is located at the plasma membrane of male gametes. Additional information The paper describes a proteome analysis of P. berghei male gametes. 615 proteins were recovered,amongst them the 11 enzymes of the glycolytic pathway. The hexose transporter was localized to the gamete plasma membrane and evidence is presented that microgamete motility can be suppressed effectively by inhibitors of this transporter and of the glycolytic pathway. Other mutants See also the mutants with search term 'hexose transporter'.

Tagged: Mutant parasite with a tagged gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_0302500

Gene Model P. falciparum ortholog

PF3D7_0204700

Gene product

hexose transporter

Gene product: Alternative name

hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1

top of page

Details of the genetic modification

Name of the tag

c-myc

Details of tagging

C-terminal

Additional remarks: tagging

Commercial source of tag-antibodies

Type of plasmid/construct

(Linear) plasmid single cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

One-thousand and thirty bp of the P. berghei hexose transporter gene (PBANKA_030250) were amplified in a two-step PCR to insert an EcoRV linearization site for subsequent transfection. AdvantageII Taq polymerase (Takara Bioscience) was used for all amplifications. Primers F (GGGGTACCTGGTGTATTGCATCAGTTAT, KpnI site in italics) and MR (GAAAACCTGATATCATACATCCT) as well as MF (AGGATGTATGATATCAGGTTTTC, EcoRV site in italics) and R (TTGGGCCCAACTCTTGATTTGCTTATATGTT, ApaI site in italics) were used for the first PCR. The products of these PCRs were then used as templates for the second PCR with primers F and R. The resulting fragment was inserted into vector p0007 (courtesy of J D Raine) to produce pHTmyc. This plasmid contains the hexose transporter homology region; two c-myc tags followed by the 3′UTR from P. berghei dhfr and the Toxoplasma gondii dhfr/ts resistance cassette.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page