| top of page |
| Details of the target gene |
| Gene Model of Rodent Parasite |
PBANKA_0302500
|
| Gene Model P. falciparum ortholog |
PF3D7_0204700
|
| Gene product | hexose transporter |
| Gene product: Alternative name | hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1 |
| top of page |
| Details of the genetic modification |
| Name of the tag | c-myc |
| Details of tagging | C-terminal |
| Additional remarks: tagging | |
| Commercial source of tag-antibodies | |
| Type of plasmid/construct | (Linear) plasmid single cross-over |
| PlasmoGEM (Sanger) construct/vector used | No |
| Modified PlasmoGEM construct/vector used | No
|
| Plasmid/construct map |
|
| Plasmid/construct sequence |
|
| Restriction sites to linearize plasmid |
|
| Selectable marker used to select the mutant parasite | tgdhfr |
| Promoter of the selectable marker | pbdhfr |
| Selection (positive) procedure | pyrimethamine |
| Selection (negative) procedure | No |
| Additional remarks genetic modification | One-thousand and thirty bp of the P. berghei hexose transporter gene (PBANKA_030250) were amplified in a two-step PCR to insert an EcoRV linearization site for subsequent transfection. AdvantageII Taq polymerase (Takara Bioscience) was used for all amplifications. Primers F (GGGGTACCTGGTGTATTGCATCAGTTAT, KpnI site in italics) and MR (GAAAACCTGATATCATACATCCT) as well as MF (AGGATGTATGATATCAGGTTTTC, EcoRV site in italics) and R (TTGGGCCCAACTCTTGATTTGCTTATATGTT, ApaI site in italics) were used for the first PCR. The products of these PCRs were then used as templates for the second PCR with primers F and R. The resulting fragment was inserted into vector p0007 (courtesy of J D Raine) to produce pHTmyc. This plasmid contains the hexose transporter homology region; two c-myc tags followed by the 3′UTR from P. berghei dhfr and the Toxoplasma gondii dhfr/ts resistance cassette. |
| Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| Sequence Primer 1 | |
| Additional information primer 1 | |
| Sequence Primer 2 | |
| Additional information primer 2 | |
| Sequence Primer 3 | |
| Additional information primer 3 | |
| Sequence Primer 4 | |
| Additional information primer 4 | |
| Sequence Primer 5 | |
| Additional information primer 5 | |
| Sequence Primer 6 | |
| Additional information primer 6 | |
|
|
| top of page |