RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1105
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1126200; Gene model (P.falciparum): PF3D7_0627500; Gene product: protein DJ-1 (DJ1)
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_1126200; Gene model (P.falciparum): PF3D7_0627500; Gene product: protein DJ-1 (DJ1)
3'UTR: Gene model: Not available; Gene product: Not available (P. vivax actin)
Replacement locus: Gene model: PBANKA_1126200; Gene product: protein DJ-1, putative (DJ1)
Phenotype Asexual bloodstage; Oocyst;
Last modified: 16 August 2014, 21:23
  *RMgm-1105
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25097910
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherSinghal N; Sijwali PS
Name Group/DepartmentCSIR
Name InstituteCentre for Cellular and Molecular Biology
CityHyderabad
CountryIndia
Name of the mutant parasite
RMgm numberRMgm-1105
Principal nameDJ1 KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNo detailed analyses of the growth(cycle) of mutant parasites. Infected Balb/c mice had lower parasitemias and prolonged survival time.
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystReduced (2x) oocyst production
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of DJ1 and expresses GFP under control of the DJ1 promoter

Protein (function)
Malaria parasites encode a conserved protein which is named plasmoDJ1 on the basis of the presence of a putative cysteine protease motif of the DJ-1/PfpI superfamily. Proteins belonging to the DJ-1/PfpI superfamily of other organisms have been shown to protect from a variety of stresses, including oxidative, thermal and pH stress. All DJ-1/PfpI members share a region designated GATase1-DJ-1 (type 1 glutamine amidotransferase-DJ-1) or DJ-1_PfpI. This region contains a typical nucleophile elbow with a positionally conserved cysteine residue in structures of several DJ-1/PfpI proteins. Hence a large number of these proteins are predicted to be proteases and have been put in the peptidase family C56. Family members in other organisms have been shown to be involved in protection of (oxidative) stress, protease activity, chaparone and antioxidant activities

Phenotype
No detailed analyses of the growth(cycle) of mutant parasites. Infected Balb/c mice had lower parasitemias and prolonged survival time. These results indicate a decreased virulence. Reduced (2x) oocyst production. Sporozoites and liver stages have not been analysed.

Additional information
Evidence is presented that P. falciparum DJ1 has chaparone and protease activity (and expression increases in blood stages under 'stress' conditions)
Evidence for (diffuse) cytosolic localisation in all blood stages, including gametocytes.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1126200
Gene Model P. falciparum ortholog PF3D7_0627500
Gene productprotein DJ-1
Gene product: Alternative nameDJ1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerP. yoellii a-tubulin
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationSee the paper for the complex construction of the knock-out vector
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAATGGCGCGCCGCAAAGAATAATAACGGTATATTTATACTAC
Additional information primer 1PbDJ1-5UK-F
Sequence Primer 2AATAGCGGCCGCAATGCTTATTCCGGTTTAACACTG
Additional information primer 2PbDJ1-5UK-R
Sequence Primer 3AAATCCCGGGTGTGTAACATCTCTTGGACCAGG
Additional information primer 3PbDJ1-3UK-F
Sequence Primer 4CATTCTCGAGTTGCAGTATACTTTTCTGGAATTTTCCA
Additional information primer 4PbDJ1-3UK-R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerP. yoellii a-tubulin
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationSee the paper for the complex construction of the knock-out vector
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1126200
Gene Model P. falciparum ortholog PF3D7_0627500
Gene productprotein DJ-1
Gene product: Alternative nameDJ1
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative nameP. vivax actin
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_1126200
Gene productprotein DJ-1, putative
Gene product: Alternative nameDJ1
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4