RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-11
Malaria parasiteP. berghei
Genotype
Transgene
 Transgene Plasmodium: Gene model: PF3D7_1133400; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1 (AMA1)
Promoter: Gene model: PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1 (AMA1; pb66)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Phenotype Asexual bloodstage;
Last modified: 31 July 2012, 19:33
  *RMgm-11
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 9614123
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
top of page
The mutant parasite was generated by
Name PI/ResearcherC.H.M. Kocken; A.M. Voorberg-v.d. Wel, C.J.Janse; A.P. Waters; A.W. Thomas
Name Group/DepartmentDepartment of Parasitology
Name InstituteBPRC
CityRijswijk
CountryThe Netherlands
top of page
Name of the mutant parasite
RMgm numberRMgm-11
Principal namenot available
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationNo
top of page
Phenotype
Asexual blood stageP. berghei schizonts with 6 or more nuclei express correctly folded and processed P. falciparum AMA-1. The protein was correctly localized in the rhoptries (see also additional remarks phenotype)
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses the AMA-1 of P. falciparum (PF11_0344) under the control of the promoter of P. berghei AMA-1 (PB000821.01.0).

Phenotype
Under control of this promoter the protein was correctly folded, processed and localized in the rhoptries of merozoites. No expression of the P. falciparum AMA-1 was observed in gametocytes.

Other mutants
In the same study a mutant was generated that expresses AMA-1 of P. falciparum (PF11_0344) under the control of the promoter of P. berghei dhfr/ts (PB000415.02.0) . Under control of this promoter the timing of expression was not correct (expression starts in maturing trophozoites) and the protein was not correctly transported and localized.

  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: Plasmodium
Gene Model of Parasite PF3D7_1133400
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative nameAMA1
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructCircular plasmid
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe transgene ama-1 of P. falciparum (PF11_0344) is under the control of 1.5kb of the promoter region of the P. berghei homolog of ama-1 (PB000415.02.0)
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative nameAMA1; pb66
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1ATTCCCATGGAACCAAAATAAC
Additional information primer 1fwd pb13
Sequence Primer 2TTTTATATCGTTTTATTTTATTAATATTTTTAATTTAC
Additional information primer 2rev pb8
top of page
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionNot available
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: StudioDrie StudioDrie; S. Mededovic and A. van Wigcheren