RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1099
Malaria parasiteP. yoelii
Genotype
DisruptedGene model (rodent): PY17X_0306600; Gene model (P.falciparum): PF3D7_0208900; Gene product: 6-cysteine protein (P230p; 230p)
Transgene
Transgene not Plasmodium: eGFP
Promoter: Gene model: PYYM_0712000; Gene model (P.falciparum): Not available; Gene product: heat shock protein, putative (HSP70)
3'UTR: Gene model: Not available; Gene product: Not available
Replacement locus: Gene model: PY17X_0306600; Gene product: 6-cysteine protein (P230p; 230p)
PhenotypeNo phenotype has been described
Last modified: 21 July 2014, 10:09
  *RMgm-1099
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25012929
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. yoelii
Parent strain/lineP. y. yoelii 17XNL
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherHart RJ; Aly AS
Name Group/DepartmentDepartment of TropicalMedicine
Name InstituteTulane University
CityNewOrleans
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-1099
Principal namePyp230p(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of the 6-cystein protein P230p and expresses GFP under the control of the strong and constitutive hsp70 promoter.

Protein (function)
The P230p protein is a member of a small family of proteins, the 6-cysteine (cys) family of (surface) proteins. The proteins are characterized by domains of roughly 120 amino acids in size that contain six positionally conserved cysteines (6-cys). Although some species of Plasmodium (may) contain unique members of the 6-cys family, ten members have been identified that are conserved both in structure as well as in genome organization throughout the genus. Some of the conserved 6-cys proteins are encoded by genes that form paralogous gene-pairs which are closely linked in the genome separated by less then 2 kb of intergenic region. Most members have a GPI anchor and are predicted membrane surface proteins whereas others appear to be secreted and most members are expressed in a discrete stage-specific manner in gametocytes, sporozoites or merozoites (see also 'Additional Information'). Evidence has been presented that P230p is specifically expressed in gametocytes of P. berghei. However, the P230p protein is not essential throughout the complete life cycle of both P. berghei and P. yoelii (see also mutants RMgm-351, RMgm-352 and RMgm-688).

Phenotype
Blood stage development, and production of gametocytes, ookinetes, oocysts and sporozoites were similar to that of wild type parasites.
Also analysis of other mutants lacking expression of P230p indicate that the P230p protein is not essential throughout the complete life cycle of both P. berghei and P. yoelii (see mutants RMgm-351, RMgm-352 and RMgm-688).

Additional information

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PY17X_0306600
Gene Model P. falciparum ortholog PF3D7_0208900
Gene product6-cysteine protein
Gene product: Alternative nameP230p; 230p
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGCCGCGGATGATAAACCATATTTTGAAGAAATTATTAGTGA
Additional information primer 141
Sequence Primer 2TCCGGATCCGCTTATTCTGGATTTTCAAATGAATAGTTAATAA
Additional information primer 242
Sequence Primer 3GCCCAAGCTTCTTTAAGAAATTATGAACAATTCAAGCAATCCAA
Additional information primer 343
Sequence Primer 4TCCGGTACCTTCCTAATATATATGATTTATAAATTAATTTGAT
Additional information primer 444
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameeGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PYYM_0712000
Gene Model P. falciparum ortholog Not available
Gene productheat shock protein, putative
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PY17X_0306600
Gene product6-cysteine protein
Gene product: Alternative nameP230p; 230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4