RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1093
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0517600; Gene model (P.falciparum): PF3D7_1033800; Gene product: plasmepsin VII
Transgene
 Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_0711900; Gene model (P.falciparum): PF3D7_0818900; Gene product: heat shock protein 70 (HSP70)
3'UTR: Gene model: PBANKA_0711900; Gene product: heat shock protein 70 (HSP70)
Replacement locus: Gene model: PBANKA_0517600; Gene product: plasmepsin VII
PhenotypeNo phenotype has been described
Last modified: 8 June 2014, 11:56
  *RMgm-1093
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24893340
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherMastan BS; Kumar, KA
Name Group/DepartmentDepartment of Animal Sciences
Name InstituteSchool of Life Sciences, University of Hyderabad
CityHyderabad
CountryIndia
top of page
Name of the mutant parasite
RMgm numberRMgm-1093
Principal namepm vii KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageNot different from wild type
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Plasmepsin VII and expreses GFP under the control of the constitutive HSP70 promoter

Protein (function)
P. berghei has 7 plasmepsins (aspartic proteases (PM IV-PM X). PM IV has a role in hemoglobin digestion (RMgm-314, RMgm-315, RMgm-316). P. falciparum PM V performs a critic role in the endoplasmic reticulum processing the PEXEL sequence of exported proteins. PM VI, VII, VII are not expressed in asexual blood stages; these are expressed in gametocytes/ookinetes/oocysts. PM VI plays an essential role in the formation of sporozoites within the oocyst (RMgm-97).

Phenotype
The mutant shows a normal development throughout the complete life cycle

Additional information
RT-PCR analyses of mosquito stages showed highest expression in 4-8 day oocysts.
No expression was detected in liver stages

Other mutants
See the link plasmepsin

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0517600
Gene Model P. falciparum ortholog PF3D7_1033800
Gene productplasmepsin VII
Gene product: Alternative name
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe DNA construct used to disrupt plasmepsin VII contains a GFP expression cassette (under the control of HSP70 regulatory sequences)
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CTCGAGGGAGCAATTATGTTACTATATC
Additional information primer 1650 bp of 5'
Sequence Primer 2ATCGATGGTTTATACACTTGTACGACA
Additional information primer 2650 bp of 5'
Sequence Primer 3GCGGCCGCCCTGAATGGAAAAGAATACATA
Additional information primer 3550 bp of 3'
Sequence Primer 4GGCGCGCCCCACTATTTAACCACACGATT
Additional information primer 4550 bp of 3'
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe DNA construct used to disrupt plasmepsin VII contains a GFP expression cassette (under the control of HSP70 regulatory sequences)
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0711900
Gene Model P. falciparum ortholog PF3D7_0818900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite PBANKA_0711900
Gene productheat shock protein 70
Gene product: Alternative nameHSP70
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0517600
Gene productplasmepsin VII
Gene product: Alternative name
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren