RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1090
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1132000; Gene model (P.falciparum): PF3D7_1355700; Gene product: NLI interacting factor-like phosphatase, putative (NIF3)
Name tag: GFP
Phenotype Asexual bloodstage; Gametocyte/Gamete; Fertilization and ookinete; Oocyst;
Last modified: 18 July 2014, 11:23
  *RMgm-1090
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25011111
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherDS Guttery, AA Holder, R Tewari
Name Group/DepartmentMalaria Research Group/School of Life Sciences
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-1090
Principal nameNIF3-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageGFP-tagged protein expression
Gametocyte/GameteGFP-tagged protein expression (female gametocyte)
Fertilization and ookineteGFP-tagged protein expression
OocystGFP-tagged protein expression
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a C-terminal GFP-tagged version of NIF3.

Protein (function)
The gene was targetted for deletion/tagging in a systematic functional analysis of the entire P. berghei protein phosphatome, which comprises 30 predicted protein phosphatases (PPs), that exhibit differential and distinct expression patterns during various stages of the life-cycle. Gene disruption analysis of all P. berghei PPs revealed that half of the genes are likely essential for asexual blood stage development; whereas six are essential for sexual development/sporogony in the mosquito.
The parasite utilises a number of signal transduction mechanisms, including reversible protein phosphorylation catalysed by protein kinases (PKs) and phosphatases (PPs). This mechanism of signalling is a conserved, ubiquitous regulatory process for many eukaryotic and prokaryotic cellular pathways.

Sequence analysis of the P. falciparum parasite has revealed approximately 85 putative PK and 27 putative PP catalytic subunits encoded in its genome (the Plasmodium protein phosphatome being one of the smallest of the eukaryotic phyla).
The Plasmodium phosphatome has been classified into 4 major groups: phosphoprotein phosphatases (PPPs), metallo-dependent protein phosphatases (PPMs), protein tyrosine phosphatases (PTPs) and NLI interacting factor-like phosphatases (NIFs), as well as a number of smaller classes.

To define the phosphatome, PPs encoded in the genomes of P. berghei and P. falciparum were identified by similarity to hidden Markov models of known PP catalytic domains. PFam domains were used to define protein sets with similarity to PPP, PTP, PPM, NIF-like and PTP-like A families. There are no predicted PPs with good similarity to the Low-Molecular Weight Phosphatase (LMWP) or CDC25 families. There are also no good matches to models of SSU72 RNA polymerase II CTD phosphatase or Eyes Absent (EYA) phosphatase. Other PFam domains specific to PP catalytic domains are subclasses of the above families. The 5 identified Plasmodium PP families were compared to 4969 PP-like proteins from 44 diverse eukaryotes, to classify them and eliminate PP-like proteins with confirmed non-protein phosphatase functions.

In this study 30 and 29 PPs were identified in the genomes of P. berghei and P. falciparum respectively, encompassing 28 direct orthologues across the 5 PP families described above.
As found with the kinome, the phosphatome is highly conserved with only three proteins without direct orthology between P. falciparum and P. berghei.
On the basis of catalytic domain phylogeny and domain architecture, the Plasmodium PPPtype phosphatases can be further classified into subfamilies, with PPP1 to PPP7 corresponding to the animal PP1-PP7 types. Plasmodium PPPs also include the BSU-like phosphatase PPKL, an EF-hand containing phosphatase (EFPP) and the two SHLPs, none of which is present in the host.

Phenotype
GFP-tagged protein expression in asexual blood stages, feamle gametocytes, ookinetes, oocysts.
Not analysed: sporozoites, liver stages

Additional information

Other mutants


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1132000
Gene Model P. falciparum ortholog PF3D7_1355700
Gene productNLI interacting factor-like phosphatase, putative
Gene product: Alternative nameNIF3
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGTACCCGCGATTCTAGATCCCGATAGAACC
Additional information primer 1T0581
Sequence Primer 2CCCCGGGCCCTTTGTCATTTTGAATAACTTTATC
Additional information primer 2T0582
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6