SummaryRMgm-108
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 18974882 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | E. Lasonder, C.J. Janse, H.G. Stunnenberg |
Name Group/Department | Department of Molecular Biology |
Name Institute | NCMLS, Radboud University Nijmegen |
City | Nijmegen |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-108 |
Principal name | 802cl1; 838 |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Oocyst numbers in A. stephensi were comparable to wild type (ranging from 150–250 oocysts per mosquito). Sporozoite formation blocked inside the oocysts. No sporozoite formation was detectable within the oocysts by either fluorescence or phase-contrast microscopy. |
Sporozoite | Sporozoite formation blocked inside the oocysts. No sporozoite formation was detectable within the oocysts by either fluorescence or phase-contrast microscopy. No sporozoites in salivary glands. No blood stage infection in C57BL/6 mice after feeding of infected mosquitoes on these mice. |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1309600 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1445800 | ||||||||||||||||||||||||
Gene product | conserved Plasmodium membrane protein, unknown function | ||||||||||||||||||||||||
Gene product: Alternative name | |||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
GCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGAAATTA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | See for more information about the disruption Lasonder, E. et al., 2008, PloS Pathogens 10, e10000195 (Supporting Information: S3). | ||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | The genetic modification results in the disruption of the following gene models PB101363.00.0 and PB000829.02.0 and PB105739.00.0 (= PF14_0435). See for more information about the disruption Lasonder, E. et al., 2008, PloS Pathogens 10, e10000195 (Supporting Information: S3). | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |