SummaryRMgm-104
|
Successful modification | The gene/parasite could not be changed/generated by the genetic modification. |
The following genetic modifications were attempted | Gene disruption |
Number of attempts to introduce the genetic modification | 3 |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 18974882 |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190). |
top of page | |
Attempts to generate the mutant parasite were performed by | |
Name PI/Researcher | E. Lasonder, C.J. Janse, H.G. Stunnenberg |
Name Group/Department | Department of Molecular Biology |
Name Institute | NCMLS, Radboud University Nijmegen |
City | Nijmegen |
Country | The Netherlands |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0209000 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0104100 | ||||||||||||||||||||||||
Gene product | conserved Plasmodium membrane protein, unknown function | ||||||||||||||||||||||||
Gene product: Alternative name | |||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
CGATAAGCTTGCATGCCTGCAGGTCAACAATAAATAATAAATAAATATTGTGGAAATAAA
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Partial | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | See for more information about the disruption Lasonder, E. et al., 2008, PloS Pathogens 10, e10000195 (Supporting Information: S3). | ||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | The protein was detected in a proteome analysis of P. falciparum oocysts and sporozoites and was found in oocyst-derived sporozoites and in salivary gland sporozoites. It contains a transmembrane region. See for more information about the disruption Lasonder, E. et al., 2008, PloS Pathogens 10, e10000195 (Supporting Information: S3). | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |