SummaryRMgm-1025
|
||||||||
*RMgm-1025| Successful modification | The parasite was generated by the genetic modification |
| The mutant contains the following genetic modification(s) | Gene mutation |
| Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 24670267 |
| MR4 number | |
| top of page | |
| Parent parasite used to introduce the genetic modification | |
| Rodent Malaria Parasite | P. berghei |
| Parent strain/line | P. berghei ANKA |
| Name parent line/clone | P. berghei ANKA 2.34 |
| Other information parent line | P. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943). |
| top of page | |
| The mutant parasite was generated by | |
| Name PI/Researcher | Honma, A; Tanabe, K. |
| Name Group/Department | Laboratory of Malariology |
| Name Institute | Research Institute for Microbial Diseases, Osaka University |
| City | Suita, Osaka |
| Country | Japan |
| top of page | |
| Name of the mutant parasite | |
| RMgm number | RMgm-1025 |
| Principal name | PbMut |
| Alternative name | |
| Standardized name | |
| Is the mutant parasite cloned after genetic modification | Yes |
| top of page | |
| Phenotype | |
| Asexual blood stage | PbMut and PbCtl parasites were maintained by weekly passage in ddY mice for 122 weeks. High-throughput genome sequencing analysis revealed that two PbMut lines had 175–178 mutations and a 86- to 90-fold higher mutation rate than that of a PbCtl line. PbMut, PbCtl, and their parent strain, PbWT, showed similar course of infection. |
| Gametocyte/Gamete | PbMut lines lost gametocyte production during serial passage in mice |
| Fertilization and ookinete | Not tested |
| Oocyst | Not tested |
| Sporozoite | Not tested |
| Liver stage | Not tested |
| Additional remarks phenotype | Mutant/mutation Other mutants |
Mutated: Mutant parasite with a mutated gene| top of page | |||||||||||||||||||||||||||
| Details of the target gene | |||||||||||||||||||||||||||
| Gene Model of Rodent Parasite | PBANKA_0501300 | ||||||||||||||||||||||||||
| Gene Model P. falciparum ortholog | PF3D7_1017000 | ||||||||||||||||||||||||||
| Gene product | DNA polymerase delta catalytic subunit | ||||||||||||||||||||||||||
| Gene product: Alternative name | |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||
| Details of the genetic modification | |||||||||||||||||||||||||||
| Short description of the mutation | Two amino acid residues (D311, E313), critical for proofreading in yeast, mutated to alanine | ||||||||||||||||||||||||||
| Inducable system used | No | ||||||||||||||||||||||||||
| Short description of the conditional mutagenesis | Not available | ||||||||||||||||||||||||||
| Additional remarks inducable system |
![]() ![]() The two amino acid residues (D311, E313), known to be critical for the proofreading activity of S. cerevisiae DNA polymerase-δ, are mutated to alanine | ||||||||||||||||||||||||||
| Type of plasmid/construct | Plasmid double cross-over | ||||||||||||||||||||||||||
| PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
| Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
| Plasmid/construct map | |||||||||||||||||||||||||||
| Plasmid/construct sequence | |||||||||||||||||||||||||||
| Restriction sites to linearize plasmid | |||||||||||||||||||||||||||
| Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
| Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
| Selection (positive) procedure | No | ||||||||||||||||||||||||||
| Selection (negative) procedure | No | ||||||||||||||||||||||||||
| Additional remarks genetic modification | Primer sequences: see below. The putative full-length P. berghei catalytic subunit of the DNA polymerase-δ (PbPolDel) gene (pbpoldel) (PBANKA_050130) was amplified using the primers PolORF-attB1-F/PolORF-attB2-R and cloned into the pDONRP1-P2R plasmid (Invitrogen) to generate the pORF plasmid. PbPolDel possessed the two amino acid residues (D311 and E313), which are known to be critical for the proofreading activity of S. cerevisiae DNA polymerase-δ. These amino acid residues were mutated to alanine with a site-directed mutagenesis kit (Agilent) using the pORF plasmid as a template and the primers Mut-F/Mut-R to generate the pORFmut plasmid. The 5′ noncoding region (−2036 to −1) of pbpoldel was amplified using the primers Pol5UTR-attB4-F/Pol5UTR-attB1-R and cloned into pDONRP4-P1R (Invitrogen) to generate the p5UTR plasmid. The 3′ noncoding region (−477 to −1) of the P. berghei dihydrofolate reductase-thymidylate synthase (PbDHFR) gene was amplified with the primers PbDHFRF-attB2-F/PbDHFRR-attB3-R and cloned into the pDONRP2-P3R plasmid (Invitrogen) to generate the pPbDHFR3UTR plasmid. The 3′ noncoding region of pbpoldel was amplified using the primers Pol3UTR-KpnI-F/Pol3UTR-EcoRV-R. The PCR product was digested with KpnI and EcoRV and cloned into the corresponding restriction site in the pL0007 plasmid (obtained from MR4) to generate pL0007::3UTR plasmid. Subsequently, a R4-R3 fragment was amplified from pDEST R4-R3 plasmid (Invitrogen) with the primers R4R3-HindIII-F/ R4R3-HindIII-R and cloned into the HindIII site of pL0007::3UTR to generate a destination plasmid (R4-R3::pL0007::3UTR). The three entry plasmids (p5UTR, pORFmut, and pPbDHFR3UTR) were then cloned into the R4-R3::pL0007::3UTR plasmid by Multisite Gateway (Invitrogen) to generate the final plasmid, PbPolDelMut. A control plasmid containing the non-mutated PbPolDel (PbPolDelCtl) was constructed in a similar way using the procedures described above. The PbPolDelMut plasmid was digested with ApaI and EcoRV, and it was introduced electroporetically into P. berghei (ANKA strain clone 2.34, referred to as PbWT), where the endogenous pbpoldel was replaced with PbPolDelMut by double crossover homologous recombination. PolORF-attB1-F GGGGACAAGTTTGTACAAAAAAGCAGGCTACAAAAAATGGAAAAAAATATATTCTCG PolORF-attB2-R GGGGACCACTTTGTACAAGAAAGCTGGGTTTACCATTCAATTTTGAGGGATGTAACTTG Mut-F CCCAAATTAAGAATCCTTTCCTTTGCTATTGCGTGTATAAAATTAGATGGAAAAGGT Mut-R ACCTTTTCCATCTAATTTTATACACGCAATAGCAAAGGAAAGGATTCTTAATTTGGG Pol5UTR-attB4-F GGGGACAACTTTGTATAGAAAAGTTGGGGCCCACAAAAAATGGAAAAAAATATATTCTCG Pol5UTR-attB1-R GGGGACTGCTTTTTTGTACAAACTTGTTACCATTCAATTTTGAGGGATGTAACTTG PbDHFRF-attB2-F GGGGACAGCTTTCTTGTACAAAGTGGCGGAAATACAGAAGCTAGCTTTG PbDHFRR-attB3-R GGGGACAACTTTGTATAATAAAGTTGGAAATTGAAGGAAAAAACATCA Pol3UTR-KpnI-F GGTACCAAAAAATAAAAATAACAAGAGGG Pol3UTR-EcoRV-R GATATCGAGAAATTATAGGGCGTT R4R3-HindIII-F AAGCTTAGCTATGACCATGATTACGCCAAGC R4R3-HindIII-R AAGCTTCAGCTATGACCATGATTACGCCAAGC | ||||||||||||||||||||||||||
| Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
| top of page | |||||||||||||||||||||||||||