RMgmDB - Rodent Malaria genetically modified Parasites

Summary

RMgm-1001
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1022500; Gene model (P.falciparum): PF3D7_1420700; Gene product: surface protein P113 (Pf113)
Phenotype Liver stage;
Last modified: 25 March 2014, 14:01
  *RMgm-1001
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 24657782
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherOffeddu, V; Matuschewski, K.
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-1001
Principal namep113(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageSporozoites show normal gliding motility, attachment to hepatocytes and invasion of hepatocytes (possibly an enhanced invasion rate). Reduced liver stage development as shown by a prolonged pre-patent period (possibly due to reduced transformation of intracellular sporozoites into early liver stages and reduced production of merozoites).
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of P113.

Protein (function)
P113 has a putative GPI anchor and amino terminal signal peptide. The P. falciparum ortholog has been isolated from blood stages in raft-like, detergent-resistant membranes. PfP113 was also detected  in gametocytes and sporozoites.

Phenotype
Only  clones of a single mutant have been analysed. Normal blood stage and mosquito stage development. Sporozoites show normal gliding motility, attachment to hepatocytes and invasion of hepatocytes (possibly an enhanced invasion rate). Reduced liver stage development as shown by a prolonged pre-patent period (possibly due to reduced transformation of intracellular sporozoites into early liver stages and reduced production of merozoites).

Additional information
Expression (analysed by RT-qPCR) showed expression on schizonts and slivary gland sporozoites (upregulated in comparison with midgut-sporozoites) and in (all) liver stages.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1022500
Gene Model P. falciparum ortholog PF3D7_1420700
Gene productsurface protein P113
Gene product: Alternative namePf113
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGACCGCGGATTACATCAAGTTTCCCCATAGC
Additional information primer 15’ KO flank for
Sequence Primer 2ATAGCGGCCGCTGACAATAGTAATAAATCATAGGATGC
Additional information primer 25’ KO flank rev
Sequence Primer 3CCGAAGCTTATTACGACACCGCCTCTG
Additional information primer 33’ KO flank for
Sequence Primer 4AGCGGTACCGAGAGCCAGGCATCAAAG
Additional information primer 43’ KO flank rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6