top of page |
Details of the target gene |
Gene Model of Rodent Parasite |
PBANKA_0915000
|
Gene Model P. falciparum ortholog |
PF3D7_1133400
|
Gene product | apical membrane antigen 1 |
Gene product: Alternative name | AMA1 |
top of page |
Details of the genetic modification |
Inducable system used | No |
Additional remarks inducable system |
|
Type of plasmid/construct used | Plasmid double cross-over |
PlasmoGEM (Sanger) construct/vector used | No |
Modified PlasmoGEM construct/vector used | No
|
Plasmid/construct map |
|
Plasmid/construct sequence |
|
Restriction sites to linearize plasmid |
|
Partial or complete disruption of the gene | Complete |
Additional remarks partial/complete disruption |
|
Selectable marker used to select the mutant parasite | tgdhfr |
Promoter of the selectable marker | pbdhfr |
Selection (positive) procedure | pyrimethamine |
Selection (negative) procedure | No |
Additional remarks genetic modification | The attempts to disrupt ama-1 (apical membrane antigen 1 precursor, putative; pb66) have not been published. Homologous replacement of the P. berghei ama-1 with its own gene was successful (A.M. Voorberg-v.d. Well, unpublished observations). Attempts to dirupt the homolog of P. falciparum (PF11_0344) also failed (Triglia et al., (2000), Mol. Microbiol. 38: 706-18). |
Additional remarks selection procedure | |
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
Sequence Primer 1 | ATTCCCATGGAACCAAAATAAC |
Additional information primer 1 | fwd pb13 (1,5kb) |
Sequence Primer 2 | TTTTATATCGTTTTATTTTATTAATATTTTTAATTTAC |
Additional information primer 2 | rev pb8 (1,5kb) |
Sequence Primer 3 | GTAAAATATTAACTAGCC |
Additional information primer 3 | fwd Pb15 (0.6kb) |
Sequence Primer 4 | ATGATAATAAAACATCAC |
Additional information primer 4 | rev Pb16 (o.6kb) |
Sequence Primer 5 | |
Additional information primer 5 | |
Sequence Primer 6 | |
Additional information primer 6 | |
|
top of page |