Back to search resultsSummaryRMgm-931
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 24509910 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | T. Annoura; S.M. Khan; C.J. Janse |
Name Group/Department | Leiden Malaria Research Group |
Name Institute | Leiden University Medical Center (LUMC) |
City | Leiden |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-931 |
Principal name | 1353cl2 |
Alternative name | Δsequestrin-b |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Not different from wild type |
Oocyst | Not different from wild type |
Sporozoite | Not different from wild type |
Liver stage | Mutant sporozoites showed normal gliding motility and WT-levels of hepatocyte invasion. Mice infected with either 1 or 5x104 PbΔsequestrin sporozoites, intravenously, had a 2-3 day delay in blood-stage patency when compared to WT sporozoites infections and 4 out of 11 mice did not develop a blood-stage infection after inoculation with 1x104 sporozoites. These observations show that liver stage development is strongly affected in the absence of sequestrin and the 2-3 day prolonged prepatent period is indicative of a >99% reduction in liver-stage development. PbΔsequestrin liver stages have normal morphology, with respect to cell division, size and PVM formation at 24hpi. However at 48hpi, as determined by staining with anti-MSP1 antibodies, all liver-stage parasites were MSP1 negative. To investigate the maturation of these parasites, 54hpi parasites were examined using anti-MSP1 and anti-EXP1 antibodies. Over 60% WT parasites at this time point were strongly MSP1 positive, whereas the majority of PbΔsequestrin parasites were MSP1 negative, with only around 7% of parasites exhibiting similar MSP1 staining. |
Additional remarks phenotype | Mutant/mutation Supporting Figure S4 Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1003000 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0405300 | ||||||||||||||||||||||||
Gene product | liver specific protein 2, putative | sequestrin | 6-cysteine protein | ||||||||||||||||||||||||
Gene product: Alternative name | LISP2 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | (Linear) plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence |
AGCTTGCATGCCTGCAGGTCAACAATAAATAATAAATAAATATTGTGGAAATAAAATAAC
| ||||||||||||||||||||||||
Restriction sites to linearize plasmid | |||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |