Summary

RMgm-93
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1129000; Gene model (P.falciparum): PF3D7_0630200; Gene product: secreted ookinete protein, putative (PSOP6, putative secreted ookinete protein 6)
PhenotypeNo phenotype has been described
Last modified: 12 September 2010, 12:21
  *RMgm-93
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 18761621
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherA. Ecker; R.E. Sinden
Name Group/DepartmentDivision of Cell and Molecular Biology
Name InstituteImperial College
CityLondon
CountryUnited Kingdom

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1129000
Gene Model P. falciparum ortholog PF3D7_0630200
Gene productsecreted ookinete protein, putative
Gene product: Alternative namePSOP6, putative secreted ookinete protein 6
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe PSOP6 protein is detected in a proteome analysis of ookinetes.

Integration of the gene targeting construct into the genomic locus was detected in some transfections by diagnostic PCR, suggesting that these genes are not essential in the asexual blood stages. However, the mutants were never abundant enough in the mixed drug-resistant populations which also contains episome-containing wild type parasites) to allow cloning. It is unclear whether this is due to technical reasons or a reduced growth rate of the mutants.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TTGGGCCCGGATCTTTGTAACATTTGGCATG
Additional information primer 1AE06a (ApaI),
Sequence Primer 2CCAAGCTTTTTATATCCACACAGTGTAAGAG
Additional information primer 2AE06b (HindIII),
Sequence Primer 3TGAATTCAGTAAAATGCACACACAACATTC
Additional information primer 3AE06c (EcoRI),
Sequence Primer 4GGGGATCCTTGGCATAACATATAATTTCACG
Additional information primer 4AE06d (BamHI),
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6