RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-847
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0102300; Gene model (P.falciparum): PF3D7_0603500; Gene product: cation/H+ antiporter (CAH; pfCAX; pbCAX)
Transgene
Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Fertilization and ookinete; Oocyst;
Last modified: 2 November 2016, 10:52
  *RMgm-847
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23468629
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineP.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherGuttery DS; Tewari R; Staines HM
Name Group/DepartmentCentre for Genetics and Genomics, School of Biology, Queens Medical Centre
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-847
Principal nameΔpbcax
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal gametocyte production. Normal exflagellation of male gametocytes. No ookinetes are formed. Parasites failed to develop further from ‘round’ form zygotes into mature ookinetes
OocystNormal gametocyte production. Normal exflagellation of male gametocytes. No ookinetes are formed. No oocysts are formed.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of cation/H+ antiporter (PbCAX) and expresses GFP under control of the constitutieve eef1a promoter

Protein (function)
Ca2+/H+ exchanger (PfCAX, also termed the Ca2+/H+ antiporter, PfCHA) has been identidied in P. falciparum. PfCAX and other apicomplexan orthologues belong to the Ca2+/cation antiporter (CaCA) superfamily CAX genes are classified into 3 subfamilies. Type II CAXs are found in fungi, Dictyostelium, and lower vertebrates and Type III CAXs are found in bacteria, while Type I CAXs include bacterial, fungal, plant and protozoan CAXs. Type I CAXs are divided into 8 subgroups (A to H) and protozoa are classified into the Type I-C phylogenetic group. Functional characterisation of CAX proteins (mainly from plants and fungi) has shown that these H+ coupled exchangers all transport Ca2+, with some being highly specific for Ca2+, whilst others mediate the transport of a broad range of additional divalent cations or, in some cases, transport additional monovalent cations. Their primary role in plants and fungi is to enable tolerance to high extracellular Ca2+concentrations, by internal sequestration of Ca2+into acidic organelles when cytosolic levels rise

Phenotype
The phenotype analyses indicate that PbCAX has no essential role in asexual blood stages. Phenotype analyses indicate that PbCAX is involved in development of the female gamete/zygote into ookinetes. Mutant parasites failed to develop further from ‘round’ form zygotes into mature ookinetes.

Additional information
Phenotype analyses indicate that PbCAX is involved in development of the female gamete/zygote into ookinetes. Mutant parasites failed to develop further from ‘round’ form zygotes into mature ookinetes.
Δpbcaxx female gametes/zygotes were still round in form, fewer in number and were often smaller in size and had degenerated membranes. They often had diffuse nuclei, suggestive of possible necrosis or late stage apoptosis.
Evidence is presented that this phenotype could be rescued by removal of extracellular Ca2+ from the culture medium in which ookinetes were cultured. Ca2+ was removed by adding the Ca2+ chelator EGTA (ethylene glycol tetraacetic acid) to the culture medium.

Analysis of a mutant expressing a C-terminal GFP-tagged version of PbCAX (RMgm-848) showed only very low level, diffuse fluorescence signals in asexual blood stages, with stronger parasite-associated GFP signals observed only on rare occasions. Stronger GFP signal was observed in female but not male gametocytes and the same was true for gametes. Thus, the asexual parasites with stronger GFP signal may have been immature female gametocyte stages. Good GFP signal was also observed in zygotes, ookinetes and oocysts. Little GFP-signal co-localised with Mito-Tracker, used as a marker for the parasite mitochondrion.

In vitro cross-fertilisation experiments were performed of Δpbcax gametes with
either wild type male (nek2- or nek4- males) or wild type female gametes (map2- females). Crossing Δpbcax with nek2- or nek4- resulted in recovered ookinete conversion of 14 and 13%, respectively. This is due to the fertilisation of female Δpbcax parasites by functional nek2- or nek4- male gametes. However, crossing Δpbcax with map2- resulted in recovered ookinete conversion of 42%. This is due to the fertilisation of functional map2-female gametes by male Δpbcax parasites. These data suggest that PbCAX activity, while not specific, is predominantly important to female gametes.

Analysis of P. falciparum PfCAX has demonstrated Ca2+/H+ exchange activity, an ability to exchange a limited range of other divalent cations, and a high transport capacity but low affinity (Km value of ,2 mM) for Ca2+, when expressed in Xenopus oocytes. In vivo studies characterising PfCAX were consistent with an atypical localisation to the inner mitochondrial membrane, and an atypical function, where the protein provides a pathway for removal of Ca2+ from this organelle back into the parasite cytosol.

The studies on P. berghei PbCAX provided no evidence for a location or role in mitochondria.

PfCAX has a predicted mitochondrial targeting sequence at residues 11–18 (YVRRTISQ), consistent with mitochondrial localisation, and this is conserved throughout the apicomplexan CAXs. Interestingly, this protein sequence has been identified in phosphoproteomic studies, using preparations derived from mature trophozoite-infected erythrocytes, and two of these residues, T15 and S17, are putative phospho-acceptor sites (with ascores of 1000, suggesting the annotations have a high degree of confidence). Phosphorylation of the S17 residue of PbCAX has also been reported, in a similar study, using ookinete preparations (available on GeneDB). The homologous protein region of TgCAX was also identified in tachyzoite preparations, although it contained no phosphorylated sites. However, neighbouring residues at positions S26, S27 and T46 were identified as being phosphorylated, albeit with lower ascores of 19, 13 and 6, respectively. Previous work has demonstrated that phosphorylation of the mitochondrial signal sequence of 29,39-cyclic nucleotide-39-phosphodiesterase 2 (CNP2) alters its localisation so that it is retained in the cytoplasm and its possible a similar mechanism could alter the location of apicomplexan CAXs. However, the localisation evidence presented for PbCAX provides little evidence for mitochondrial function of CAXs in apicomplexan parasites.

Other mutants
RMgm-846: an independent mutant lacking expression of PbCAX
RMgm-848: a mutant expressing a C-terminal GFP- tagged version of PbCAX


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0102300
Gene Model P. falciparum ortholog PF3D7_0603500
Gene productcation/H+ antiporter
Gene product: Alternative nameCAH; pfCAX; pbCAX
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe pbcax knock-out vectors were constructed for a double cross-over homologous recombination in the pBS-DHFR plasmid that contains a Toxoplasma gondii dhfr/ts cassette conferring resistance to pyrimethamine. The knock-out construct was generated by inserting 507 bp of the pbcax 5' untranslated (UTR) region upstream and 497 bp of the pbcax 3' UTR region downstream of the dhfr cassette. The final knock-out construct was digested with ApaI and NotI to release the fragment for transfection. Transfection of P. berghei parasites with the knock-out construct was carried out in both wild-type parasites and in a line that constitutively expresses cytosolic GFP
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGGCCCCAGTAATGATGTTCCCATAC
Additional information primer 1N0431
Sequence Primer 2GGGGAAGCTTCTCAATACATTCATTGTATGGCTC
Additional information primer 2N0432
Sequence Primer 3CCCCGAATTCGCTAATTACTGCTTATCTTATTG
Additional information primer 3N0433
Sequence Primer 4GGGGTCTAGAGTAATAAATGTACTGTATGTG
Additional information primer 4N0434
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
" 1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt
51 tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta
101 atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg
151 aatggcgaat ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg
201 tatttcacac cgcatatggt gcactctcag tacaatctgc tctgatgccg
251 catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga
301 cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc
351 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga
401 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata
451 ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg
501 aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca
551 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
601 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
651 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
701 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac
751 agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat
801 gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg
851 ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
901 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt
951 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca
1001 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg
1051 cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct
1101 gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa
1151 tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
1201 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc
1251 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg
1301 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat
1351 ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac
1401 tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta
1451 agcattggta actgtcagac caagtttact catatatact ttagattgat
1501 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga
1551 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt
1601 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg
1651 cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt
1701 ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct
1751 tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct
1851 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg
1901 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga
1951 acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga
2001 actgagatac ctacagcgtg agcattgaga aagcgccacg cttcccgaag
2051 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag
2101 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt
2151 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
2201 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc
2251 ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc
2301 tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc
2351 gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
2401 gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta
2451 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca
2501 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac
2551 tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt
2601 tcacacagga aacagctatg accatgatta cgccaagctt ccgcgggtat
2651 atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct
2701 ataaataaat ttacagattt attttttaat acaaaagata tagatatacc
2751 agaaataaat gatcagttta aaggttttaa attctttatg acatcattta
2801 taaatcatgg atcatatcca ctaacaatag aatgtggtgt aacaaatggt
2851 ggaactagtt ataaaagagc aattatttta ttgcatgttc gaactgattt
2901 aaaagataga ccagtttcat tttgtgattt tcgaaaagga gaattatata
2951 attatttgaa tgcttatact gaaggggatg tatgcataat aatttccaaa
3001 tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc
3051 aaaaaattgt tttacgcaag tatatgaaaa agggtatcta aatgacgcca
3101 ataaaattaa tactaaaaat gttattaact attcatttga aaatccagaa
3151 tatgcgctag ctggttytaa ttatacatta acaaaatcgt atcaatttga
3201 atgtcattgt gtagataaag aaacagaaca aattgtaaaa acggttttag
3251 tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg
3301 gtgaatcaca aacctattat tgcacatcca aataaaacac atcaagcttg
3351 catgcctgca gcccagctta attcttttcg agctctttat gcttaagttt
3401 acaatttaat attcatactt taagtatttt ttgtagtatc ctagatattg
3451 tgctttaaat gctcacccct caaagcacca gtaatatttt catccactga
3501 aataccatta aattttcaaa aaaatactat gcatataatg ttatacatat
3551 aaacataaaa cgccatgtaa atcaaaaaat atataaaaat atgtataaaa
3601 ataaatatgc actaaatata agctaattat gcataaaaat taaagtgccc
3651 tttattaact agtcgtaatt atttatattt ctatgttata aaaaaatcct
3701 catataataa tataattaat atatgtaatg ttttttttat tttataattt
3751 taatataaaa taatatgtaa attaattcaa aaaataaata taattgttgt
3801 gaaacaaaaa acgtaatttt ttcatttgcc ttcaaaattt aaatttattt
3851 taatatttcc taaaatatat atactttgtg tataaatata taaaaatata
3901 tatttgctta taaataaata aaaaatttta taaaacatag ggggatccat
3951 gagtaaagga gaagaacttt tcactggagt tgtcccaatt cttgttgaat
4001 tagatggtga tgttaatggg cacaaatttt ctgtcagtgg agagggtgaa
4051 ggtgatgcaa catacggaaa acttaccctt aaatttattt gcactactgg
4101 aaaactacct gttccatggc caacacttgt cactactttc ggttatggtg
4151 ttcaatgctt tgcgagatac ccagatcata tgaaacagca tgactttttc
4201 aagagtgcca tgcccgaagg ttatgtacag gaaagaacta tatttttcaa
4251 agatgacggg aactacaaga cacgtgctga agtcaagttt gaaggtgata
4301 cccttgttaa tagaatcgag ttaaaaggta ttgattttaa agaagatgga
4351 aacattcttg gacacaaatt ggaatacaac tataactcac acaatgtata
4401 catcatggca gacaaacaaa agaatggaat caaagttaac ttcaaaatta
4451 gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa
4501 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct
4551 gtccacacaa tctgcccttt cgaaagatcc caacgaaaag agagaccaca
4601 tggtccttct tgagtttgta acagctgctg ggattacaca tggcatggat
4651 gaactataca aataaatgga tcccgttttt cttacttata tatttatacc
4701 aattgattgt atttataact gtaaaaatgt gtatgttgtg tgcatatttt
4751 tttttgtgca tgcacatgca tgtaaatagc taaaattatg aacattttat
4801 tttttgttca gaaaaaaaaa actttacaca cataaaatgg ctagtatgaa
4851 tagccatatt ttatataaat taaatcctat gaatttatga ccatattaaa
4901 aatttagata tttatggaac ataatatgtt tgaaacaata agacaaaatt
4951 attattatta ttattatttt tactgttata attatgttgt ctcttcaatg
5001 attcataaat agttggactt gatttttaaa atgtttataa tatgattagc
5051 atagttaaat aaaaaaagtt gaaaaattaa aaaaaaacat ataaacacaa
5101 atgatgtttt ttccttcaat ttcgggtacc gagctcgaat tctcttgagc
5151 ccgttaatga aatagataca attcattcat gttatataca tctagaacat
5201 aatctgaata tggttcaagt taaatgtcca aaaattataa aaagtgatga
5251 tatttttgat ggtaatacca taatagacac caaggtaaca tcacgaagta
5301 gtcaacaaaa taatttttat ttagaaaata cagatgttga accagaagaa
5351 atagagaaat ataaaaatat agaatacata ccagaaaacg atgaagtaat
5401 gcatctagac aaaaaagaaa agctagatga tatattacca ggtgttatca
5451 tattagataa aaataaaatg ttcaaagaaa aaggacattt cacttttgtt
5501 actccattaa ttgtagaaaa ggtattaata ttaaaaatat attgtgataa
5551 tactaaaaca ataattaata atatgaaagg gaaaaaaggt attacagtaa
5601 taaggatttc tcaaaataca acaaaaaata aattttatgg atgtgacttt
5651 tcaggtaatt ctaaaaaaac attttactat tccaatgttt atgatttaga
5701 aaaaaaaaat gagttttgtg aaatagaatt aaaagaaaat atagtagtta
5751 gcttaaattg tccaactggt aaaattaatc caaaaaattg ttttagaaat
5801 gtatatataa aaagtaatat gaatgaacaa acaaccgaaa atatagaaaa
5851 tatatttaac gaaataaaag ttatagatgc agattatttt ataaataatt
5901 catcaacctt tttgatgatt tccaaaatta caaaaaaaga gtttgatttt
5951 tattgtacat gtgaagatta taaaaccaaa aatataggaa caatatatat
6001 taaaaattat gaatatctag attcaaaacc taaatataaa aataaacaaa
6051 tttcctatat agatgtagtt ccatacccgc ggggaaaggg cg"
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15'-cccaagcttccgcgggtatatggtaaagaacctactaacac
Additional information primer 1primer L1345: 0.7kb 5'region of PBANKA_030600 (230p gene)5'-cccaagcttgatgtgttttatttggatgtgc
Sequence Primer 25'-cccaagcttgatgtgttttatttggatgtgc
Additional information primer 2primer L1346: 0.7kb 5'region of PBANKA_030600 (230p gene)
Sequence Primer 35'-ccggaattctcttgagcccgttaatg
Additional information primer 3primer L1347: 1kb 3'region of PBANKA_030600 (230p gene)
Sequence Primer 45'-tccccgcgggtatggaactacatctatatagg
Additional information primer 4primer L1348: 1kb 3'region of PBANKA_030600 (230p gene)