RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-839
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1432400; Gene model (P.falciparum): PF3D7_1216700; Gene product: perforin-like protein 2 (PPLP2)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst;
Last modified: 13 March 2013, 15:27
  *RMgm-839
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23461714
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherDeligianni, E.; Siden-Kiamos, I.
Name Group/DepartmentInstitute of Molecular Biology and Biotechnology
Name InstituteFORTH
CityHeraklion
CountryGreece
Name of the mutant parasite
RMgm numberRMgm-839
Principal namepplp2(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNormal production of gametocytes. The production of male gametes is affected. The male gametocyte displays abnormal exflagellation; instead of forming 8 gametes, it produced only one, shared thicker flagellum. Evidence is presented that rupture of the erythrocyte membrane is blocked and thereby preventing egress of male gametes from the erythrocyte.
Fertilization and ookineteStrongly reduced ookinete production as a result of aberrant production of male gametes. The male gametocyte displays abnormal exflagellation; instead of forming 8 gametes, it produced only one, shared thicker flagellum. Evidence is presented that rupture of the erythrocyte membrane is blocked and thereby preventing egress of male gametes from the erythrocyte. Evidence is presented that female gametocytes/female gametes show normal egress from the erythrocyte.
OocystStrongly reduced oocyst production as a result of strongly reduced ookinete production.
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of perforin like protein 2  (PPLP2).

Protein (function)
The pplp2 gene is a member of a small, conserved family of proteins encoding perforin-like proteins containing membrane-attack complex/perforin domains (MACPF)(Kaiser, K et al., 2004, Mol. Biochem. Parasitol. 133, 15-26).

Phenotype
The mutant produces normal numbers of gametocytes. However, the production of male gametes is affected. The male gametocyte displays abnormal exflagellation; instead of forming 8 gametes, it produced only one, shared thicker flagellum. Evidence is presented that rupture of the erythrocyte membrane is blocked and thereby preventing egress of male gametes from the erythrocyte. Evidence is presented that the parasitophorous vacuole membrane is ruptured normally in activated mutant male gametocytes.
Evidence is presented that female gametocytes/female gametes show normal egress from the erythrocyte (see below).

The mutant produces low numbers of ookinetes, oocysts and sporozoites. Sporozoites are infectious to mice. These results indicate that PPLP2 has a specific role in egress of male gametocytes/gametes from the erythrocyte.

Additional information
Pplp2 mRNA was exclusively detected in gametocytes and ookinetes (by RT-PCR). The protein was only  detected in gametocytes and not in ookinetes which may indicate that  the signal detected in the RT-PCR analysis may originate from gametocytes remaining in the ookinete preparation. Expression of PPLP2 could not be detected in asexual parasites of parasites which are deficient in the production of gametocytes.
The PPLP2 protein was only detected in P. berghei male and not in P. berghei female gametocytes (in P. falciparum PPLP2 was detected in both male and female gametocytes). The PPLP2 protein could not be detected in activated male gametocytes rapidly after activation of male gametocytes,

Crossing of pplp2(-) mutant females with wild type male gametes resulted in normal ookinete formation in vitro. This result indicates that female gametocytes/female gametes show normal egress from the erythrocyte and that the female gametes are fertile.

Other mutants


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1432400
Gene Model P. falciparum ortholog PF3D7_1216700
Gene productperforin-like protein 2
Gene product: Alternative namePPLP2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, BamHI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPlasmid pDpplp2 for the gene disruption was constructed in the standard vector pL0001. 579 bp from the 5’ end of the ORF of pplp2 and a 591 bp fragment of the 3’ end were amplified from P. berghei genomic DNA. The two fragments were cloned into the KpnI and HindIII sites and the EcoRI and BamHI sites, respectively. The plasmid was digested with KpnI and BamHI before transfection. After double cross-over integration of the construct 1562 bp in the middle of the target gene were replaced by the TgDHFR/TS cassette.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGGGTACCGATTCTTTGGGTAAAAGACA
Additional information primer 1per5F; 5' targeting region
Sequence Primer 2CCCAAGCTTATCAAATTCATTTCCTGTGT
Additional information primer 2per5R; 5' targeting region
Sequence Primer 3GGAATTCGGAAATGGGTTTACAAATAA
Additional information primer 3per3F; 3' targeting region
Sequence Primer 4CGGGATCCGGGAGTGTTTGTCTTTCTTA
Additional information primer 4per3R; 3' targeting region
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6