Summary

RMgm-812
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1002400; Gene model (P.falciparum): PF3D7_0404700; Gene product: dipeptidyl aminopeptidase 3 (DPAP3)
Transgene
Transgene not Plasmodium: A fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Promoter: Gene model: PBANKA_0915000; Gene model (P.falciparum): PF3D7_1133400; Gene product: apical membrane antigen 1 (ama-1)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Asexual bloodstage;
Last modified: 23 December 2016, 17:35
  *RMgm-812
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 25941254
Reference 2 (PMID number) : 27991544
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 1037m1f1mocl1 (RMgm-32)
Other information parent lineP. berghei ANKA 1037m1f1mocl1 (1037cl1; RMgm-32) is a reference ANKA mutant line which expresses GFP-luciferase under control of a schizont-specific promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 20019192).
The mutant parasite was generated by
Name PI/ResearcherJ. Lin; C.J. Janse; S.M. Khan
Name Group/DepartmentLeiden Malaria Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-812
Principal name2057cl1; 2110cl1
Alternative name∆dpap3-a; ∆dpap3-b
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNormal growth/multiplication of blood stages during the first 5-7 days after (mechanical) infection. Reduced complications of experimental cerebral malaria (ECM).
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of DPAP3 and expresses the GFP-Luciferase fusion protein under control of the (schizont specific) ama-1 promoter.

Protein (function)
The P. falciparum and P. berghei genomes each contain three dipeptidyl aminopeptidase (dpap) homologs. P. falciparum DPAP1 and DPAP3 are critical for asexual growth. The P. falciparum dpap2 gene could be deleted. Parasites lacking expression of (the gametocyte-specific?) DPAP2 produced normal gametocytes.

DPAP3 of P. falciparum has been implicated in egress of merozoites from the host erythrocyte.

Evidence has been presented that the P. falciparum enzyme dipeptidyl aminopeptidase 1 (DPAP1; an ortholog of the lysosomal exopeptidase cathepsin C) was located in the food/digestive vacuole and to possesses hydrolytic activity against dipeptide substrates, suggesting that DPAP1 is involved in the generation of dipeptides from hemoglobin-derived oligopeptides. The dpap1 gene could not be deleted from the P. falciparum genome, suggesting an essential role during blood stage growth/multiplication.

In P. berghei all three dpap genes can be deleted from the genome (see below).

Phenotype
Blood stages showed a normal growth/development (blood stages produced normal levels of hemozoin). See also 'additional information' on the reduction of experimental cerebral malaria complications (ECM) in mice infected with this mutant

Additional information
See below for genotyping:

This mutant is also used in the study: Capuccini B et al (2016). Sci Rep. 2016 Dec 19;6:39258 (PMID: 27991544). The following was found:
'In order to determine whether the changes in microglia revealed in the microarray were generated only in an infection that gave rise to ECM, we compared responses of microglia obtained at day 7 from ECM-causing PbA infection with that of a mutant of PbA, which does not cause ECM. For this we used a gene-deletion mutant for the dipeptidyl peptidase 3 (DPAP3), Δdpap3. Infection with 105 or 104 iRBC of PbA Δdpap3 resulted in a gradually increasing parasitemia and approximately 85% to 100% survival of mice up to 20 days of infection, with low or no clinical signs of ECM. For the first 5 to 7 days of infection the parasitemias were similar to those of wt PbA.
There was no significant increase in the numbers of microglia recovered at day 7 from the PbA Δdpap3 infection in contrast to the 3-fold increase observed in microglia from the wt PbA infection. We performed quantitative RT-qPCR on microglia isolated from both infections for the genes, Oasl1, IRF7, H2-Q8, Cxcl10 and Ccl5. Only microglia from wt PbA infections causing ECM show significant fold increases in expression of any of these genes (Fig. 4e). These data suggest that activation of microglia may be feature of ECM'.

Genotyping:



Generation of the P. berghei mutants ∆dpap1 (RMgm-810), ∆dpap2 (RMgm-811) and ∆dpap3 (RMgm-812).
(primer sequences can either be found in Lin et al. (2015). J. Exp. Med. or obtained from the Leiden Malaria Research Group)
(A) Schematic representation of the gene-deletion constructs targeting the ORF of genes expressing dipeptidyl peptidases 1-3 (dpap1-3) by double cross-over homologous recombination and the wt gene loci before and after disruption. The constructs contain a drug-selectable marker cassette (SM; black box) and gene target regions (hatched boxes). Primer positions (arrows) for diagnostic PCRs are shown (see Table S4 for primer sequences and expected product sizes). (B) Diagnostic PCR (left, center) and RT-PCR (right) analysis confirm correct disruption of dpap1 in ∆dpap1-a. For diagnostic PCRs, the following primers were used: 5’ in, RS672/RS32; 3’ in, RS110/RS673; SM (tgdhfr/ts), RS404/RS405; dpap1 ORF, RS582/RS583. For RT-PCR the following primers were used: tub (tubulin), RS782/RS783 and dpap1, RS582/RS583. (C) Diagnostic PCR (left) and Southern analysis of pulsed field gel-separated (center) confirm correct disruption of dpap1 in ∆dpap1-b. Northern analysis of blood-stage mRNA (right) confirms the absence of dpap1 transcripts in the ∆dpap1-a mutant. The following primers were used for diagnostic PCRs: 5' integration (5’ in), L6204/L4770; 3' integration (3’ in), L4771/L6205; SM (hdfhr::yfcu), L4698/L4699; dpap1 ORF, L6206/L6207. For Southern analysis, separated chromosomes were hybridized using an hdhfr probe that recognizes the construct integrated into the dpap1 locus on chromosome 9. Northern blot was hybridized using a PCR probe recognizing the dpap1 ORF (primers L6206/L6207). As a loading control, hybridization was performed with oligonucleotide probe L644R that recognizes the large subunit rRNA. (D) Diagnostic PCR (left) and Southern analysis of pulsed field gel-separated chromosomes (center) confirms correct disruption of dpap2 in mutant ∆dpap2. Northern analysis of blood-stage mRNA (right) confirms the absence of dpap2 transcripts in the ∆dpap2 mutant. The following primers were used for diagnostic PCRs: 5’ in, L6935/L4770; 3’ in, L4771/L6936; SM (hdfhr::yfcu), L4698/L4699; dpap2 ORF, L6937/L6938. Separated chromosomes were hybridized using a 3’UTR pbdhfr probe that recognizes the construct integrated into dpap2 on chromosome 14, the endogenous dhfr/ts on chromosome 7 and the GFP-luciferase reporter cassette in the 230p locus on chromosome 3. Northern blot was hybridized using a PCR probe recognizing the dpap2 ORF (primers L6937/L6938) and with an oligonucleotide probe L644R recognizing the large subunit rRNA (as loading control). (E) Diagnostic PCR (left) and Southern analysis of pulsed field gelseparated chromosomes (center) confirm correct disruption of dpap3 in ∆dpap3-a and ∆dpap3-b. Northern analysis of blood-stage mRNA (right) confirms the absence of dpap3 transcripts. The following primers were used for diagnostic PCRs: 5’ in, L6941/L4770; 3’ in, L4771/L6942; SM (hdfhr::yfcu), L4698/L4699; dpap3 ORF, L6943/L6944. Separated chromosomes were hybridized using a 3’UTR pbdhfr probe that recognizes the construct integrated into dpap3 on chromosome 10, the endogenous dhfr/ts on chromosome 7 and the GFP-luciferase reporter cassette in the 230p locus on chromosome 3. Northern blot was hybridized using a PCR probe recognizing the dpap3 ORF (primers L6943/L6944) and with an oligonucleotide probe L644R recognizing the large subunit rRNA (as loading control). See Table S4 for primers used for generation of probes.

Other mutants
RMgm-810: mutant lacking expression of DPAP1
RMgm-811: mutant lacking expression of DPAP2
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1002400
Gene Model P. falciparum ortholog PF3D7_0404700
Gene productdipeptidyl aminopeptidase 3
Gene product: Alternative nameDPAP3
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct used(Linear) PCR construct double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
GAACTCGTACTCCTTGGTGACGTCGCGATTCATTTTAGGCGGAGTGTATAAGTTTGAATA
CAAATAATTTTGTATATTTTACACATTTATTTATTACAGATATCTCCATGTAATTGTATA
TTTATATATCTTTGTTATTTTTACAATTTTTTAAGAAAAAATTTTGTTTATGTTTTGTTT
TCTATTTAAATGTTGCTCTAAATATCTATGCACACATGTGCATAATTTTCTTTAAAAATG
TAATTTAATTTTATTTATTCTGAAAAGACGGCGTGATGCCGGGAATATGTTTACTCTCAT
ATTTTTTTTTTAGTTATTTTCAATTCATTCCCTTTTGTAGTTGCAATTTGTTTAATCTCC
TTTTATACACCATGCATGTATAATAAATGAGGATGTGCGTGTGTTGTTGTAAAATAATTA
TATAACTTTATTTTCTTTTGGAATTTTGTTGTTTTGTTTGTTTTTATACTAGGTAGTGTA
GTAGAAATAATATGCGTTCTAGTGCATATTAAAATATTAAATAAAAATAAATTAATATGA
ATAGCATAATAATAGAGAAAACAACCACCAAAAACAATTAAGGATTTTTAATATACAAAA
ATTATTTCTTTAGAATCACGTTGTAGCATTGATATTTAATTCCTATAAAAATTAATGAAA
AATGAAATATAAAAATCATTTTTCATGTATAGCATGCCTACTAATGATGACTGATTTTTT
TTGAATTAATTTTTTTTAATTATTGAAGGGCCGGGATATGTGTCTGCATTTCTTCCCATG
TCACATATAGTTATCCGTTTTCAGAGGTCGACGATGCTTGTAGATGGCCCAGCTTAATTC
TTTTCGAGCTCTTTATGCTTAAGTTTACAATTTAATATTCATACTTTAAGTATTTTTTGT
AGTATCCTAGATATTGTGCTTTAAATGCTCACCCCTCAAAGCACCAGTAATATTTTCATC
CACTGAAATACCATTAAATTTTCAAAAAAATACTATGCATATAATGTTATACATATAAAC
ATAAAACGCCATGTAAATCAAAAAATATATAAAAATATGTATAAAAATAAATATGCACTA
AATATAAGCTAATTATGCATAAAAATTAAAGTGCCCTTTATTAACTAGTCGTAATTATTT
ATATTTCTATGTTATAAAAAAATCCTCATATAATAATATAATTAATATATGTAATGTTTT
TTTTATTTTATAATTTTAATATAAAATAATATGTAAATTAATTCAAAAAATAAATATAAT
TGTTGTGAAACAAAAAACGTAATTTTTTCATTTGCCTTCAAAATTTAAATTTATTTTAAT
ATTTCCTAAAATATATATACTTTGTGTATAAATATATAAAAATATATATTTGCTTATAAA
TAAATAAAAAATTTTATAAAACATAGGGGGATCCATGGTTGGTTCGCTAAACTGCATCGT
CGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCTGCCCTGGCCACCGCTCAG
GAACGAATTTAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGTAAACAGAA
TCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAA
GGGTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTT
TCTTTCCAGAAGTCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAA
AGTAGACATGGTCTGGATAGTTGGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCC
AGGCCATCTTAAACTATTTGTGACAAGGATCATGCAAGACTTTGAAAGTGACACGTTTTT
TCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATACCCAGGTGTTCTCTCTGA
TGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAATGATGCTAG
CGGAGGAGGTGGATCTGGTGGAGGTGGAAGTGCTAGCGTGACAGGGGGAATGGCAAGCAA
GTGGGATCAGAAGGGTATGGACATTGCCTATGAGGAGGCGGCCTTAGGTTACAAAGAGGG
TGGTGTTCCTATTGGCGGATGTCTTATCAATAACAAAGACGGAAGTGTTCTCGGTCGTGG
TCACAACATGAGATTTCAAAAGGGATCCGCCACACTACATGGTGAGATCTCCACTTTGGA
AAACTGTGGGAGATTAGAGGGCAAAGTGTACAAAGATACCACTTTGTATACGACGCTGTC
TCCATGCGACATGTGTACAGGTGCCATCATCATGTATGGTATTCCACGCTGTGTTGTCGG
TGAGAACGTTAATTTCAAAAGTAAGGGCGAGAAATATTTACAAACTAGAGGTCACGAGGT
TGTTGTTGTTGACGATGAGAGGTGTAAAAAGATCATGAAACAATTTATCGATGAAAGACC
TCAGGATTGGTTTGAAGATATTGGTGAGGCTTCGGAACCATTTAAGAACGTCTACTTGCT
ACCTCAAACAAACCAATTGCTGGGTTTGTACACCATCATCAGAAATAAGAATACAACTAG
ACCTGATTTCATTTTCTACTCCGATAGAATCATCAGATTGTTGGTTGAAGAAGGTTTGAA
CCATCTACCTGTGCAAAAGCAAATTGTGGAAACTGACACCAACGAAAACTTCGAAGGTGT
CTCATTCATGGGTAAAATCTGTGGTGTTTCCATTGTCAGAGCTGGTGAATCGATGGAGCA
AGGATTAAGAGACTGTTGTAGGTCTGTGCGTATCGGTAAAATTTTAATTCAAAGGGACGA
GGAGACTGCTTTACCAAAGTTATTCTACGAAAAATTACCAGAGGATATATCTGAAAGGTA
TGTCTTCCTATTAGACCCAATGCTGGCCACCGGTGGTAGTGCTATCATGGCTACAGAAGT
CTTGATTAAGAGAGGTGTTAAGCCAGAGAGAATTTACTTCTTAAACCTAATCTGTAGTAA
GGAAGGGATTGAAAAATACCATGCCGCCTTCCCAGAGGTCAGAATTGTTACTGGTGCCCT
CGACAGAGGTCTAGATGAAAACAAGTATCTAGTTCCAGGGTTGGGTGACTTTGGTGACAG
ATACTACTGTGTTTAACTCGATCCCGTTTTTCTTACTTATATATTTATACCAATTGATTG
TATTTATAACTGTAAAAATGTGTATGTTGTGTGCATATTTTTTTTTGTGCATGCACATGC
ATGTAAATAGCTAAAATTATGAACATTTTATTTTTTGTTCAGAAAAAAAAAACTTTACAC
ACATAAAATGGCTAGTATGAATAGCCATATTTTATATAAATTAAATCCTATGAATTTATG
ACCATATTAAAAATTTAGATATTTATGGAACATAATATGTTTGAAACAATAAGACAAAAT
TATTATTATTATTATTATTTTTACTGTTATAATTATGTTGTCTCTTCAATGATTCATAAA
TAGTTGGACTTGATTTTTAAAATGTTTATAATATGATTAGCATAGTTAAATAAAAAAAGT
TGAAAAATTAAAAAAAAACATATAAACACAAATGATGTTTTTTCCTTCAACCTTCAATTT
CGGATCCACTAGTATAATGGGCCTGTAGCTGCAGCAATTGAGCCATCAAAAAGTTTTATT
AAATATAAAAAAGGTATACTAACAGGAAATTTTATAAAAATGCAAGACGGTGATAAATCA
AATGCATATATATGGAATAAAGTCGATCATGCTGTTGTTATAGTTGGGTGGGGTGAAGAC
ACTATAGAAAATTTAATAAAAAAAAAAATGAAAATAAATAACTCAAAAAAAATAACTCAT
TCTTATGATGAATATAAATCAAAAAACAACGATAATTTAGATGAAAACATATATGATAAG
CATATTAATAGTTATGTAAAAAATACTAAGGAAAAAAATAAAGTTATAAAATATTGGAAA
GTTTTAAATAGTTGGGGAACGAAATGGGGATACAATGGTTACTTTTACATACTAAGAGAT
GAAAATTATTTTAATATACGATCGTATCTTTTGATATGTGATGTTAATTTATTTGTTAAG
AATAAAAATGTTAAATTATAATTGTATTATTTTTTTTAAGGTGTAACAAAAATATTCCAC
TTGCAGGTATAGCTATATGATTTATTTAACTTTTTTTCATATTTTCCACTAATTAATTGT
TATGTTGTTTGTAAACACAATTTATGATATTTAAAATCTCTTTTAAAATTACAATTCCTT
TTTACCATTTTTTTATGCATATCAATTTCGTAAACTTTAATACTCATTAAAAAAAATTGG
CATTATCGCGAGCTGAGTGTCAATGACCAACCT
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe locus was targeted using a linear construct that was generated using a 2-step, anchor tagging PCR method (for primer details see below).

The 5’- and 3’ targeting regions of the gene were PCR amplified from genomic DNA using primer pairs 1&2 and 3&4. Primers 2 and 3 have 5’-terminal extensions homologues to the hdhfr::yfcu selectable marker cassette. Primers 1 and 4 both have a 5’-terminal overhang with an anchor-tag which serves as a primer site in the 2nd PCR reaction.

The target fragments from the first PCR reaction were annealed to either side of the selectable marker cassette by PCR with anchor-tag primers 5 and 6, resulting in the 2nd PCR product. The hdhfr::yfcu selectable marker cassette used in this reaction was digested from pL0048 using restriction enzymes XhoI and NotI. pL0048 is available from The Leiden Malaria Research Group.

See for more information on the 2-step anchor tagging PCR method, the following publications:
J.W. Lin, S.M. Khan et al. A novel 'gene insertion/marker out' (GIMO) method for transgene expression and gene complementation in rodent malaria parasites PLoS One. 2011;6(12).
T. Annoura et al. Assessing the adequacy of attenuation of genetically modified malaria parasite vaccine candidates Vaccine. 2012;30(16):2662-70
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1L6931; dpap3 5’-targeting sequence, F (NruI)
Additional information primer 1GAACTCGTACTCCTTGGTGACGTCGCGATTCATTTTAGGCGGAGTG
Sequence Primer 2L6932; dpap3 5’-targeting sequence, R
Additional information primer 2CATCTACAAGCATCGTCGACCTCTGAAAACGGATAACTATATGTG
Sequence Primer 3L6933; dpap3 3’-targeting sequence, F
Additional information primer 3CCTTCAATTTCGGATCCACTAGTATAATGGGCCTGTAGCTG
Sequence Primer 4L6934; dpap3 3’-targeting sequence, R (NruI)
Additional information primer 4AGGTTGGTCATTGACACTCAGCTCGCGATAATGCCAATTTTTTTTAATGAG
Sequence Primer 5GAACTCGTACTCCTTGGTGACG
Additional information primer 5L4661; anchor tag primer
Sequence Primer 6AGGTTGGTCATTGACACTCAGC
Additional information primer 6L4662: anchor tag primer

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameA fusion of GFP (gfp-mu3) and Luciferase Firefly (LucIAV)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct(Linear) plasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markerama-1
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP-Luciferase gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP-Luciferase does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0915000
Gene Model P. falciparum ortholog PF3D7_1133400
Gene productapical membrane antigen 1
Gene product: Alternative nameama-1
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4