Summary

RMgm-799
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1003000; Gene model (P.falciparum): PF3D7_0405300; Gene product: liver specific protein 2, putative | sequestrin | 6-cysteine protein (LISP2)
Phenotype Liver stage;
Last modified: 6 November 2013, 18:48
  *RMgm-799
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 23216750
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherY. Orito; T. Ishino; M. Yuda
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University School of Medicine
CityMie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-799
Principal nameLISP2(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageSporozoites show normal hepatocyte traversal and invasion Strongly reduced liver stage development. In mice a delay of the prepatent period of 1.5 days after inoculation of sporozoites. Normal livers stage development up to 24 hour after invasion of hepatocytes. Maturing liver stage schizonts show abberrant morphology and merozoite formation is impaired (see also 'Additional Information')
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of LISP2 (Liver stage specific protein 2).
LISP2 has also be named sequestrin.

Protein (function)
PBANKA_100300 encodes a 2172 amino acid protein with a large repeat region of approximately 1000 amino acids. This region is composed of several repeat motifs, particularly 12 copies of a 56-amino acid motif. Analyses of the amino acid sequence with various structure analysis tools indicates that it has an N-terminal signal sequence but no other motifs for membrane association such as transmembrane domains or a GPI-anchor motif, suggesting that the encoded product has the structure of a secreted protein. It contains a predicted Plasmodium 6-cysteine motif. Several studies analysing expression of this protein in P. berghei (RMgm-593, RMgm-800; this study) provide evidence for specific expression in liver stages. The protein has been named LISP2 and sequestrin.

Phenotype
Phenotype analyses indicate that the protein is involved in the development of maturing liver stages. Evidence is presented that the absence of LISP2 impairs merozoite formation in liver schizonts. In this study evidence is presented for export of LISP2 into to the cytoplasm and nucleus of host hepatocytes (see also RMgm-800)

Additional information
The nuclei of maturing LISP2(-) liver schizonts in cultured hepatocytes exhibited an irregular or amorphous appearance, indicating that nuclear division was impaired in these parasites. The percentage of parasites with aberrant nucleus was nearly half of the remaining LS parasites in the LISP2-mutants. Such parasites were scarcely observed in the wild-type parasites. These results indicate that the majority of mutant parasites had failed to complete merogony and had remained in the culture, whereas the wild-type parasites had developed into merozoites and had been released into the culture medium.

Timing of expression of LISP2 was analysed through determination of expression of reporter proteins GFP and luciferase under control of the promoter region (1.2kb) of lisp2.
The gfp or luciferase genes under the control of the lisp2 promoter region were introduced using a centromere containing plasmid (Pcen rep-GFP). GFP/Luciferase expression was only detected in mid- to late liver stages (24-48 hours after invasion of sporozoites)

In this study evidence is presented for export of LISP2 into to the cytoplasm and nucleus of host hepatocytes (see also RMgm-800).

Other mutants
RMgm-593 - A mutant expressing GFP under the control of the promoter of PBANKA_100300 (named lisp2 or sequestrin)
RMgm-800 - A mutant expressing a C-terminal tagged version of PBANKA_100300 (named lisp2 or sequestrin)


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1003000
Gene Model P. falciparum ortholog PF3D7_0405300
Gene productliver specific protein 2, putative | sequestrin | 6-cysteine protein
Gene product: Alternative nameLISP2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitepbdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CATTGTCAAATTCCTTAGGCATATGTAGC
Additional information primer 1LISP2 knockout 5 forward
Sequence Primer 2GTAAACTTGGTGACGATATATTGCTGTTG
Additional information primer 2LISP2 knockout 5 reverse
Sequence Primer 3CCTTTGCATGGTGAAAAAGGTAAAC
Additional information primer 3LISP2 knockout 3 forward
Sequence Primer 4CTTCCTATCGACCTATATTTTGCTTCGTC
Additional information primer 4LISP2 knockout 3 reverse
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6