Back to search resultsSummaryRMgm-712
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene tagging |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 23197789 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA cl15cy1 |
Other information parent line | A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | E.M. Pasini, C.J. Janse, B.M.D. Franke-Fayard |
Name Group/Department | Department of Parasitology |
Name Institute | Biomedical Primate Research Centre |
City | Rijswijk |
Country | The Netherlands |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-712 |
Principal name | 1915 |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | No |
top of page | |
Phenotype | |
Asexual blood stage | The tagged-protein shows a rhoptry-like location in merozoites |
Gametocyte/Gamete | Not tested |
Fertilization and ookinete | Not tested |
Oocyst | Not tested |
Sporozoite | Not tested |
Liver stage | Not tested |
Additional remarks phenotype | Mutant/mutation |
top of page | |||||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_1400600 | ||||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0220800 | ||||||||||||||||||||||||||
Gene product | cytoadherence linked asexual protein 2 | ||||||||||||||||||||||||||
Gene product: Alternative name | CLAG2, RhopH1A | ||||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||||
Name of the tag | mCherry | ||||||||||||||||||||||||||
Details of tagging | C-terminal | ||||||||||||||||||||||||||
Additional remarks: tagging | |||||||||||||||||||||||||||
Commercial source of tag-antibodies | Clontech | ||||||||||||||||||||||||||
Type of plasmid/construct | (Linear) plasmid single cross-over | ||||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||||
Plasmid/construct sequence |
TCTGCATACAACGTTCTCTGTAAAAATTAACAAAAATCTTGATAAGTTGGACAAAGATTA
| ||||||||||||||||||||||||||
Restriction sites to linearize plasmid | ClaI | ||||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||||
Additional remarks genetic modification | |||||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||||
| |||||||||||||||||||||||||||
top of page |