RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-675
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0714300; Gene model (P.falciparum): PF3D7_0816500; Gene product: small heat shock protein HSP20, putative (HSP20)
Transgene
 Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_0403200; Gene model (P.falciparum): PF3D7_0304600; Gene product: circumsporozoite (CS) protein (CS, CSP)
3'UTR: Gene model: Not available; Gene product: Not available
Replacement locus: Gene model: PBANKA_0714300; Gene product: small heat shock protein HSP20 (HSP20)
Phenotype Fertilization and ookinete; Sporozoite; Liver stage;
Last modified: 5 January 2012, 17:35
  *RMgm-675
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 22139844
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/ResearcherMontagna, G.N.; Matuschewski, K.
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
top of page
Name of the mutant parasite
RMgm numberRMgm-675
Principal namehsp20(-)::CS-GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
top of page
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of ookinetes are produced. The speed of gliding of ookinetes obtained from in vitro cultures was moderately, albeit significantly, reduced.
OocystNot different from wild type
SporozoiteNormal production of salivary gland sporozoites. Infectivity of mutant sporozoites to mice after intravenously injection is comparable to wild type sporozoites.
Infectivity of mutant sporozoites to mice after mosquito feeding is strongly reduced.
Mutant sporozoite show aberrant motility and substrate adhesion in vitro.
Mutant sporozoites showed normal host cell traversal and invasion.
Liver stageInfectivity of mutant sporozoites to mice after intravenously injection is comparable to wild type sporozoites.
Infectivity of mutant sporozoites to mice after mosquito feeding is strongly reduced.
Mutant sporozoites showed normal host cell traversal and invasion.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of  a small heat shock protein, HSP20 and expresses GFP under the control of the promoter of the circumsporozoite protein gene (csp).

Protein
Plasmodium HSP20 was identified by homology searches using the Toxoplasma gondii HSP20 sequence (gi: 78368731) as query. Plasmodium HSP20 contains a central α-crystallin domain (Pfam: PF00011).

Phenotype
Mutant ookinetes and sporozoites show reduced and or aberrant motility. Sporozoites show reduced infectivity to mice after infection by mosquito bite and not after intravenous injection. Mutant sporozoites showed normal host cell traversal and invasion. Evidence is presented that mutant sporozoites have a specific defect in fast and circular gliding motility while retaining their full capacity to breach and eventually invade target cells.

Additional information
Analysis of expression of mCherry-tagged HSP20 (see mutant RMgm-676) and using a polyclonal antiserum against HSP20 it is shown that HSP70 is abundantly expressed in ookinetes, oocysts and sporozoites (and no or very low expression in blood stages and maturing liver stages). In addition evidence is presented that HSP20 redistributes to the apical tip in motile sporozoites. In gliding sporozoites, tagged HSP20 localizes to the plasma membrane of gliding sporozoites and accumulates at the ventral side of the anterior tip and at the posterior half. The observations in addition with immuno-electron-microscopy observations suggest that HSP20 is recruited to the cortical side of the pellicle in gliding sporozoites and that this polarization of HSP20 is a molecular signature of mature, motile, and infectious sporozoites

Other mutants
RMgm-672: An independent mutant lacking expression of HSP20 (and expressing GFP under the control of the constitutive eef1α promoter).
RMgm-676: A mutant expressing a mCherry-tagged from of HSP20

  Disrupted: Mutant parasite with a disrupted gene
top of page
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0714300
Gene Model P. falciparum ortholog PF3D7_0816500
Gene productsmall heat shock protein HSP20, putative
Gene product: Alternative nameHSP20
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, KpnI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe CS-GFP fragment was amplified using genomic DNA of the PbFluospo parasite line as template and the following primers: OScsgfpFor (5’-
ATAAGAATGCGGCCGCGACATGCATATGTGTTGGTTGTAATTGAGG-3’, NotI site is underlined) and OScsgfpRev (5’-CGCGGATCCTTATTTGTATAGTTCATCCATGCC-3’, BamHI site is underlined). The resulting 1340 bp fragment was digested with NotI and BamHI enzymes and cloned in a NotI-BamHI-linearized pHsp20repBD3+ plasmid (see RMgm-672) resulting in the pHsp20repCS-GFPBD3+ construct. Parasites were transfected with SacII-KpnI digested pHsp20repCS-GFPBD3+ plasmid, using the Nucleofector device (Amaxa GmbH) as described.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6
top of page
  Transgene: Mutant parasite expressing a transgene
top of page
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
top of page
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid SacII, KpnI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe CS-GFP fragment was amplified using genomic DNA of the PbFluospo parasite line as template and the following primers: OScsgfpFor (5’-
ATAAGAATGCGGCCGCGACATGCATATGTGTTGGTTGTAATTGAGG-3’, NotI site is underlined) and OScsgfpRev (5’-CGCGGATCCTTATTTGTATAGTTCATCCATGCC-3’, BamHI site is underlined). The resulting 1340 bp fragment was digested with NotI and BamHI enzymes and cloned in a NotI-BamHI-linearized pHsp20repBD3+ plasmid (see RMgm-672) resulting in the pHsp20repCS-GFPBD3+ construct. Parasites were transfected with SacII-KpnI digested pHsp20repCS-GFPBD3+ plasmid, using the Nucleofector device (Amaxa GmbH) as described.
Additional remarks selection procedure
top of page
Other details transgene
top of page
Promoter
Gene Model of Parasite PBANKA_0403200
Gene Model P. falciparum ortholog PF3D7_0304600
Gene productcircumsporozoite (CS) protein
Gene product: Alternative nameCS, CSP
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
top of page
3'-UTR
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative name
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0714300
Gene productsmall heat shock protein HSP20
Gene product: Alternative nameHSP20
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCCCCGCGGGGAGTTTAAAATTATTGCTAGTTC
Additional information primer 15’UTR Hsp20 SacII
Sequence Primer 2ATAAGAATGCGGCCGCACGTATGTATATATATATG
Additional information primer 25’UTR Hsp20 NotI
Sequence Primer 3CCCAAGCTTGGGGTATATGCTTGTTCATATAGTC
Additional information primer 33’UTR Hsp20
Sequence Primer 4GGGGTACCCCTATAATATTTGTGTTCTTTTTGCG
Additional information primer 43’UTR Hsp20 KpnI
top of page
Conceptual design of the database: Dr. C.J. Janse (Leiden Malaria Research Group, Leiden, The Netherlands).
Technical design and realization: S. Mededovic and A. van Wigcheren