Back to search resultsSummaryRMgm-672
|
Successful modification | The parasite was generated by the genetic modification |
The mutant contains the following genetic modification(s) | Gene disruption, Introduction of a transgene |
Reference (PubMed-PMID number) |
Reference 1 (PMID number) : 22139844 |
MR4 number | |
top of page | |
Parent parasite used to introduce the genetic modification | |
Rodent Malaria Parasite | P. berghei |
Parent strain/line | P. berghei ANKA |
Name parent line/clone | P. berghei ANKA 507cl1 (RMgm-7) |
Other information parent line | P.berghei ANKA 507cl1 (RMgm-7) is a reference ANKA mutant line which expresses GFP under control of a constitutive promoter. This reference line does not contain a drug-selectable marker (PubMed: PMID: 16242190). |
top of page | |
The mutant parasite was generated by | |
Name PI/Researcher | Montagna, G.N.; Matuschewski, K. |
Name Group/Department | Parasitology Unit |
Name Institute | Max Planck Institute for Infection Biology |
City | Berlin |
Country | Germany |
top of page | |
Name of the mutant parasite | |
RMgm number | RMgm-672 |
Principal name | hsp20(-) |
Alternative name | |
Standardized name | |
Is the mutant parasite cloned after genetic modification | Yes |
top of page | |
Phenotype | |
Asexual blood stage | Not different from wild type |
Gametocyte/Gamete | Not different from wild type |
Fertilization and ookinete | Normal numbers of ookinetes are produced. The speed of gliding of ookinetes obtained from in vitro cultures was moderately, albeit significantly, reduced. |
Oocyst | Not different from wild type |
Sporozoite | Normal production of salivary gland sporozoites. Infectivity of mutant sporozoites to mice after intravenously injection is comparable to wild type sporozoites. Infectivity of mutant sporozoites to mice after mosquito feeding is strongly reduced. Mutant sporozoite show aberrant motility and substrate adhesion in vitro. Mutant sporozoites showed normal host cell traversal and invasion. |
Liver stage | Infectivity of mutant sporozoites to mice after intravenously injection is comparable to wild type sporozoites. Infectivity of mutant sporozoites to mice after mosquito feeding is strongly reduced. Mutant sporozoites showed normal host cell traversal and invasion. |
Additional remarks phenotype | Mutant/mutation Phenotype Additional information Other mutants |
top of page | |||||||||||||||||||||||||
Details of the target gene | |||||||||||||||||||||||||
Gene Model of Rodent Parasite | PBANKA_0714300 | ||||||||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_0816500 | ||||||||||||||||||||||||
Gene product | small heat shock protein HSP20, putative | ||||||||||||||||||||||||
Gene product: Alternative name | HSP20 | ||||||||||||||||||||||||
top of page | |||||||||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||||||||
Inducable system used | No | ||||||||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||||||||
Type of plasmid/construct used | Plasmid double cross-over | ||||||||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||||||||
Plasmid/construct sequence | |||||||||||||||||||||||||
Restriction sites to linearize plasmid | SacII, KpnI | ||||||||||||||||||||||||
Partial or complete disruption of the gene | Complete | ||||||||||||||||||||||||
Additional remarks partial/complete disruption | |||||||||||||||||||||||||
Selectable marker used to select the mutant parasite | tgdhfr | ||||||||||||||||||||||||
Promoter of the selectable marker | pbdhfr | ||||||||||||||||||||||||
Selection (positive) procedure | pyrimethamine | ||||||||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||||||||
Additional remarks genetic modification | For disruption of PbHSP20 two fragments were amplified using primers 5’UTR Hsp20 SacII (5´-TCCCCGCGGGGAGTTTAAAATTATTGCTAGTTC-3´,SacII is underlined) and 5’UTR Hsp20 NotI (5´- ATAAGAATGCGGCCGCACGTATGTATATATATATG -3´; NotI site is underlined) for the 529 base pair 5´ fragment and 3’UTR Hsp20 HindIII, (5´- CCCAAGCTTGGGGTATATGCTTGTTCATATAGTC-3’; HindIII site is underlined) and 3’UTR Hsp20 KpnI (5’-GGGGTACCCCTATAATATTTGTGTTCTTTTTGCG-3´); KpnI site is underlined) for the 726 base pair 3´ fragment using P. berghei genomic DNA as template. Both fragments were cloned into the P. berghei transfection vector b3D+ resulting in the pHsp20repBD3+ plasmid. Parasites were transfected with SacII/KpnI- digested Hsp20repBD3+ plasmid, using the Nucleofector device (Amaxa GmbH), and injected into naïve mice. | ||||||||||||||||||||||||
Additional remarks selection procedure | |||||||||||||||||||||||||
Primer information: Primers used for amplification of the target sequences
Primer information: Primers used for amplification of the target sequences
| |||||||||||||||||||||||||
top of page |
top of page | |||||||||||||||||||
Type and details of transgene | |||||||||||||||||||
Is the transgene Plasmodium derived | Transgene: not Plasmodium | ||||||||||||||||||
Transgene name | GFP (gfp-mu3) | ||||||||||||||||||
top of page | |||||||||||||||||||
Details of the genetic modification | |||||||||||||||||||
Inducable system used | No | ||||||||||||||||||
Additional remarks inducable system | |||||||||||||||||||
Type of plasmid/construct | Plasmid double cross-over | ||||||||||||||||||
PlasmoGEM (Sanger) construct/vector used | No | ||||||||||||||||||
Modified PlasmoGEM construct/vector used | No | ||||||||||||||||||
Plasmid/construct map | |||||||||||||||||||
Plasmid/construct sequence |
" 1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt
| ||||||||||||||||||
Restriction sites to linearize plasmid | KspI (SacII) | ||||||||||||||||||
Selectable marker used to select the mutant parasite | gfp (FACS) | ||||||||||||||||||
Promoter of the selectable marker | eef1a | ||||||||||||||||||
Selection (positive) procedure | FACS (flowsorting) | ||||||||||||||||||
Selection (negative) procedure | No | ||||||||||||||||||
Additional remarks genetic modification | The GFP gene (1 copy) has been inserted into the 230p locus (PBANKA_030600) by double cross-over integration. | ||||||||||||||||||
Additional remarks selection procedure | This reporter mutant expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence. | ||||||||||||||||||
top of page | |||||||||||||||||||
Other details transgene | |||||||||||||||||||
top of page | |||||||||||||||||||
Promoter | |||||||||||||||||||
Gene Model of Parasite | PBANKA_1133300 | ||||||||||||||||||
Gene Model P. falciparum ortholog | PF3D7_1357100 | ||||||||||||||||||
Gene product | elongation factor 1-alpha | ||||||||||||||||||
Gene product: Alternative name | eef1a | ||||||||||||||||||
| |||||||||||||||||||
top of page | |||||||||||||||||||
3'-UTR | |||||||||||||||||||
Gene Model of Parasite | PBANKA_0719300 | ||||||||||||||||||
Gene product | bifunctional dihydrofolate reductase-thymidylate synthase, putative | ||||||||||||||||||
Gene product: Alternative name | dhfr/ts | ||||||||||||||||||
| |||||||||||||||||||
Insertion/Replacement locus | |||||||||||||||||||
Replacement / Insertion | Replacement locus | ||||||||||||||||||
Gene Model of Parasite | PBANKA_0306000 | ||||||||||||||||||
Gene product | 6-cysteine protein | ||||||||||||||||||
Gene product: Alternative name | 230p | ||||||||||||||||||
| |||||||||||||||||||
top of page |