Summary

RMgm-66
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0933700; Gene model (P.falciparum): PF3D7_1113900; Gene product: mitogen-activated protein kinase 2 (MAP2; MAP-2; MAPK2)
Phenotype Fertilization and ookinete;
Last modified: 29 March 2013, 18:29
  *RMgm-66
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 15864297
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei NK65
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherR. Rangarajan, A. Sultan, C. Doerig
Name Group/DepartmentDepartment of Immunology and Infectious Diseases
Name InstituteHarvard School of Public Health
CityBoston
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-66
Principal nameclone b1, clone c2
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteMale and female gametocyte production is not affected. No exflagellation observed in mutant clone c2 and drastically reduced in mutant clone b1, therefore, a defect in male gamete formation.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of MAP2 protein.

Protein (function)
MAP kinases are serine/threonine protein kinases involved in a variety of functions including cell proliferation.

Phenotype
The mutant produces wild-type levels of gametocytes and wild-type male:female gametocyte ratios but male gamete formation (i.e. exflagellation) is inhibited; presumably the few exflagellations seen in clone b1 represent revertant wild type parasites, but this was not tested (see also 'Additional remarks genetic modification').
The 'Oocyst' and 'Sporozoite' phenotype of the mutants has been analyzed. No oocysts were observed in mosquitoes fed on mice infected with clone c2 or b1. No sporozoites in mosquitoes fed on mice infected with clone c2. Very few sporozoites were observed with clone b1. possibly representing revertant WT parasites (see also 'Additional remarks genetic modification').

See also the paper by Dorin-Semblat D. et al. (2007, Mol Microbiol 65, 1170-1180) for unsuccessful attempts to knock-out map2 in P. falciparum, indicating that in P. falciparum map2 has an essential function during sexual blood stage development.

Additional information
Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation as integration of the KO vector was not achieved. Accesibility of the locus to recombination was verified by C-terminal tagging.

Other mutants
Independent P. berghei map2- mutants (RMgm-62RMgm-63) have been generated that also lacks MAP2 expression and also demonstrate a exflagellation and male gamete defect phenotype.


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0933700
Gene Model P. falciparum ortholog PF3D7_1113900
Gene productmitogen-activated protein kinase 2
Gene product: Alternative nameMAP2; MAP-2; MAPK2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid PstI
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe mutant has been generated using a construct that integrates by single cross-over integration. The disadvantage of using such insertion constructs is that the construct can be removed from the genome, thereby restoring the wild type genotype.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GCGTTTTCCCATACGATCATA
Additional information primer 1Primer 1
Sequence Primer 2TAGCTATATAGGATAGTATAAAAGGCAC
Additional information primer 2Primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6