Summary

RMgm-629
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0208300; Gene model (P.falciparum): PF3D7_0104800; Gene product: novel putative transporter 1, putative (Novel Putative Transporter, NPT1)
Transgene
Transgene not Plasmodium: RFP
Promoter: Gene model: PBANKA_1319500; Gene model (P.falciparum): PF3D7_1455800; Gene product: LCCL domain-containing protein (LAP4; LCCL/lectin adhesive-like protein 4; CCp2)
3'UTR: Gene model: PBANKA_1359600; Gene product: transmission blocking target antigen precursor 6-cysteine protein (P48/45)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Transgene
Transgene not Plasmodium: GFP (gfp-mut3)
Promoter: Gene model: PBANKA_0416100; Gene model (P.falciparum): PF3D7_0905300; Gene product: dynein heavy chain, putative
3'UTR: Gene model: PBANKA_1010600; Gene product: calmodulin, putative (cam)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 22 August 2011, 14:39
  *RMgm-629
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21752110
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 820cl1m1cl1 (RMgm-164)
Other information parent lineP. berghei ANKA 820cl1m1cl1 (RMgm-164) is a reference ANKA mutant line which expresses GFP under control of a male and RFP under control of a female gametocyte specific promoter (PubMed: PMID: 19438517).
The mutant parasite was generated by
Name PI/ResearcherB. Boisson; R. Ménard; P. Baldacci
Name Group/DepartmentBiologie et Génétique du Paludisme
Name InstituteInstitut Pasteur
CityParis
CountryFrance
Name of the mutant parasite
RMgm numberRMgm-629
Principal nameFluo/NPT1-Δ
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteStrongly reduced gametocyte production. The few gametocytes present show an aberrant morphology. These aberrant forms are unable to fertilize and produce ookinetes
Fertilization and ookineteNo ookinete production
OocystNo ookinete and oocyst production
SporozoiteNo ookinete, oocyst and sporozoite production
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Novel Putative Transporter, NPT1 and expresses RFP under control of a female specific promoter and GFP under control of a male specific promoter

Protein (function)
The P. falciparum (PFA0245w) homolog of P. berghei NPT1 has been reported to belong to an uncharacterized family of 5 novel putative transporters (NPTs) presenting some features of the Major Facilitating Superfamily (MFS) (Martin et al., 2005, Genome Biol.).  Plasmodium NPT1 proteins are predicted to contain 12 transmembrane domains. Transcription/expression of the npt1 gene has been shown for blood-, mosquito- and liver stages with increased transcript levels in liver stages.

Phenotype
Phenotype analyses show a strongly reduced gametocyte production. The few gametocytes present show an aberrant morphology (as shown by both ligh-microscopy and transmission electron microscopy analyses). These aberrant forms are unable to fertilize and to produce ookinetes.

Additional information
See also mutant RMgm-626. This is an independent mutant lacking expression of NPT1, generated in the P. berghei NK65 strain.

Both the production of male and female gametocytes is affected as shown by the absence of ookinetes in cross-fertilisation studies with either fertile males or fertile female gametes.

The number of gametocytes in parasites lacking expression of NPT1 is 90-95% reduced as demonstrated by FACS counting of mature gametocytes.

In the same study a mutant has been generated in which the npt1 gene was partially deleted (NPT1-I). These parasites show an unexpected presence of a long ‘chimeric’ transcript encompassing the entire disrupted locus. Since no antibodies against NPT1 could be generated, it was not possible to analyse whether these transcripts would give rise to a (truncated) NPT1 protein. This mutant showed however the same phenotype as the phenotype described here for the mutant lacking the complete npt1 gene.

In order to verify that the phenotype of mutant parasites was due solely to the genetic modifications introduced in the npt1 locus and not to other mutations that may have occurred during the selection of the parasites or to an effect on neighbouring genes, the NPT1-I strain has been complemented with an intact npt1 gene . To this end, a plasmid, c-npt1-gfp, containing 500bp of the 5’UTR, the entire ORF and 1000bp of the 3’UTR of npt1, together with gfp driven from the hsp70 promoter was inserted by single cross-over into the npt1-I locus. This insertion generated a full-length npt1 ORF driven by the native promoter and 1000bp of the endogenous 3`UTR. Phenotype analyses of the complemented parasites showed restoration of normal (wild type) gametocyte production.

Other mutants
RMgm-624: A mutant expressing a HA-tagged form of NPT1.
RMgm-626: An independent mutant lacking expression of NPT1 (in the P. berghei NK65 strain).


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0208300
Gene Model P. falciparum ortholog PF3D7_0104800
Gene productnovel putative transporter 1, putative
Gene product: Alternative nameNovel Putative Transporter, NPT1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1cgatgcgggcccctggctaattttgctattcatcattttac
Additional information primer 1Upstream targeting region forward (ApaI)
Sequence Primer 2cgatgccccgggatttcgaaataaatatattttatattctcaaatatg
Additional information primer 2Upstream targeting region reverse (XmaI)
Sequence Primer 3ccagtgagtgcggccgcgggcctgatttattcattaacctttttagc
Additional information primer 3Downstream targeting region forward (NotI)
Sequence Primer 4agctggcgcgccacagcgtgggtaaaacgaccgt
Additional information primer 4Downstream targeting region reverse (AscI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameRFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc
91 agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcctgat gcggtatttt
181 ctccttacgc atctgtgcgg tatttcacac cgcatatggt gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga
271 cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc
361 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata
451 ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg
541 tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt
631 attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca
721 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt
811 aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
901 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac
991 actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt
1081 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa
1171 ctattaactg gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc
1261 tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat
1351 ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc
1441 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc
1531 taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc
1621 aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg
1711 gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg
1891 tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg
1981 gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat
2071 ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
2161 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc
2251 ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct
2341 gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc
2431 gcgcgttggc cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag
2521 ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga
2611 aacagctatg accatgatta cgccaagctt ccgcgggtat atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct
2701 ataaataaat ttacagattt attttttaat acaaaagata tagatatacc agaaataaat gatcagttta aaggttttaa attctttatg
2791 acatcattta taaatcatgg atcatatcca ctaacaatag aatgtggtgt aacaaatggt ggaactagtt ataaaagagc aattatttta
2881 ttgcatgttc gaactgattt aaaagataga ccagtttcat tttgtgattt tcgaaaagga gaattatata attatttgaa tgcttatact
2971 gaaggggatg tatgcataat aatttccaaa tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc aaaaaattgt
3061 tttacgcaag tatatgaaaa agggtatcta aatgacgcca ataaaattaa tactaaaaat gttattaact attcatttga aaatccagaa
3151 tatgcgctag ctggttytaa ttatacatta acaaaatcgt atcaatttga atgtcattgt gtagataaag aaacagaaca aattgtaaaa
3241 acggttttag tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg gtgaatcaca aacctattat tgcacatcca
3331 aataaaacac atcaagcttg catgcctgca ggaattcgat ggccgctcta gctttgatcc cgtttttctt acttatatat ttataccaat
3421 tgattgtatt tataactgta aaaatgtgta tgttgtgtgc atattttttt ttgtgcatgc acatgcatgt aaatagctaa aattatgaac
3511 attttatttt ttgttcagaa aaaaaaaact ttacacacat aaaatggcta gtatgaatag ccatatttta tataaattaa atcctatgaa
3601 tttatgacca tattaaaaat ttagatattt atggaacata atatgtttga aacaataaga caaaattatt attattatta ttatttttac
3691 tgttataatt atgttgtctc ttcaatgatt cataaatagt tggacttgat ttttaaaatg tttataatat gattagcata gttaaataaa
3781 aaaagttgaa aaattaaaaa aaaacatata aacacaaatg atgttttttc cttcaatttc gattgataat tatgcagccc agcttaattc
3871 ttttcgagct ctttatgctt aagtttacaa tttaatattc atactttaag tattttttgt agtatcctag atattgtgct ttaaatgctc
3961 acccctcaaa gcaccagtaa tattttcatc cactgaaata ccattaaatt ttcaaaaaaa tactatgcat ataatgttat acatataaac
4051 ataaaacgcc atgtaaatca aaaaatatat aaaaatatgt ataaaaataa atatgcacta aatataagct aattatgcat aaaaattaaa
4141 gtgcccttta ttaactagaa ctagtcgtaa ttatttatat ttctatgtta taaaaaaatc ctcatataat aatataatta atatatgtaa
4231 tgtttttttt attttataat tttaatataa aataatatgt aaattaattc aaaaaataaa tataattgtt gtgaaacaaa aaacgtaatt
4321 ttttcatttg ccttcaaaat ttaaatttat tttaatattt cctaaaatat atatactttg tgtataaata tataaaaata tatatttgct
4411 tataaataaa taaaaaattt tataaaacat agggggatcc atggttggtt cgctaaactg catcgtcgct gtgtcccaga acatgggcat
4501 cggcaagaac ggggacctgc cctggccacc gctcaggaac gaatttagat atttccagag aatgaccaca acctcttcag tagaaggtaa
4591 acagaatctg gtgattatgg gtaagaagac ctggttctcc attcctgaga agaatcgacc tttaaagggt agaattaatt tagttctcag
4681 cagagaactc aaggaacctc cacaaggagc tcattttctt tccagaagtc tagatgatgc cttaaaactt actgaacaac cagaattagc
4771 aaataaagta gacatggtct ggatagttgg tggcagttct gtttataagg aagccatgaa tcacccaggc catcttaaac tatttgtgac
4861 aaggatcatg caagactttg aaagtgacac gttttttcca gaaattgatt tggagaaata taaacttctg ccagaatacc caggtgttct
4951 ctctgatgtc caggaggaga aaggcattaa gtacaaattt gaagtatatg agaagaatga tgctagcgga ggaggtggat ctggtggagg
5041 tggaagtgct agcgtgacag ggggaatggc aagcaagtgg gatcagaagg gtatggacat tgcctatgag gaggcggcct taggttacaa
5131 agagggtggt gttcctattg gcggatgtct tatcaataac aaagacggaa gtgttctcgg tcgtggtcac aacatgagat ttcaaaaggg
5221 atccgccaca ctacatggtg agatctccac tttggaaaac tgtgggagat tagagggcaa agtgtacaaa gataccactt tgtatacgac
5311 gctgtctcca tgcgacatgt gtacaggtgc catcatcatg tatggtattc cacgctgtgt tgtcggtgag aacgttaatt tcaaaagtaa
5401 gggcgagaaa tatttacaaa ctagaggtca cgaggttgtt gttgttgacg atgagaggtg taaaaagatc atgaaacaat ttatcgatga
5491 aagacctcag gattggtttg aagatattgg tgaggcttcg gaaccattta agaacgtcta cttgctacct caaacaaacc aattgctggg
5581 tttgtacacc atcatcagaa ataagaatac aactagacct gatttcattt tctactccga tagaatcatc agattgttgg ttgaagaagg
5671 tttgaaccat ctacctgtgc aaaagcaaat tgtggaaact gacaccaacg aaaacttcga aggtgtctca ttcatgggta aaatctgtgg
5761 tgtttccatt gtcagagctg gtgaatcgat ggagcaagga ttaagagact gttgtaggtc tgtgcgtatc ggtaaaattt taattcaaag
5851 ggacgaggag actgctttac caaagttatt ctacgaaaaa ttaccagagg atatatctga aaggtatgtc ttcctattag acccaatgct
5941 ggccaccggt ggtagtgcta tcatggctac agaagtcttg attaagagag gtgttaagcc agagagaatt tacttcttaa acctaatctg
6031 tagtaaggaa gggattgaaa aataccatgc cgccttccca gaggtcagaa ttgttactgg tgccctcgac agaggtctag atgaaaacaa
6121 gtatctagtt ccagggttgg gtgactttgg tgacagatac tactgtgttt aactcgatcc cgtttttctt acttatatat ttataccaat
6211 tgattgtatt tataactgta aaaatgtgta tgttgtgtgc atattttttt ttgtgcatgc acatgcatgt aaatagctaa aattatgaac
6301 attttatttt ttgttcagaa aaaaaaaact ttacacacat aaaatggcta gtatgaatag ccatatttta tataaattaa atcctatgaa
6391 tttatgacca tattaaaaat ttagatattt atggaacata atatgtttga aacaataaga caaaattatt attattatta ttatttttac
6481 tgttataatt atgttgtctc ttcaatgatt cataaatagt tggacttgat ttttaaaatg tttataatat gattagcata gttaaataaa
6571 aaaagttgaa aaattaaaaa aaaacatata aacacaaatg atgttttttc cttcaatttc gggtaccgac catataagaa ttaacccttt
6661 acttttttcg tatttttcat taacttccat ttgttaattt tttaaaataa gtttttattt tcaataaaaa aactatatta atttaatcta
6751 attataagca aaaaattaaa ttcaaagaat aaaattatat gcacataatg tgtgcccctt taaaacaaat attcgatgtt taattcgtac
6841 tttatgctaa ttttttatta ttcacagatt ttatattaga gttataaaaa tttagaattt tttcaagtaa aatattatta gttaatggca
6931 ttaaaatgta taaggaaaag ttaatataaa aattaaaaaa aacagttaca cgtatattac gcatacaacg atgtatatat attcatatat
7021 attaataatt ctagagtcgc ggccgcttta cttgtacagc tcgtccatgc cgagagtgat cccggcggcg gtcacgaact ccagcaggac
7111 catgtgatcg cgcttctcgt tggggtcttt gctcagggcg gactgggtgc tcaggtagtg gttgtcgggc agcagcacgg ggccgtcgcc
7201 gatgggggtg ttctgctggt agtggtcggc gagctgcacg ctgccgtcct cgatgttgtg gcggatcttg aagttcacct tgatgccgtt
7291 cttctgcttg tcggccatga tatagacgtt gtggctgttg tagttgtact ccagcttgtg ccccaggatg ttgccgtcct ccttgaagtc
7381 gatgcccttc agctcgatgc ggttcaccag ggtgtcgccc tcgaacttca cctcggcgcg ggtcttgtag ttgccgtcgt ccttgaagaa
7471 gatggtgcgc tcctggacgt agccttcggg catggcggac ttgaagaagt cgtgctgctt catgtggtcg gggtagcggc tgaagcactg
7561 cacgccgtag gtcagggtgg tcacgagggt gggccagggc acgggcagct tgccggtggt gcagatgaac ttcagggtca gcttgccgta
7651 ggtggcatcg ccctcgccct cgccggacac gctgaacttg tggccgttta cgtcgccgtc cagctcgacc aggatgggca ccaccccggt
7741 gaacagctcc tcgcccttgc tcaccatggt ggcgaccggt ggatcctttt tatcatttgg ataattaatt cttatattta ttctgaatta
7831 aatcaaactt cctattcata tgtacatgca tctatatgta tgaaatacat ataatactac tatataccac caaattacat atccaaataa
7921 cttgtgccct taacactgca tatatatgtt tgtccatata tttgcaaata tctatatata ctataaacct tatgcacaaa cccctttttc
8011 gcatataaaa atgaatatat atatatatat atatatatac tgtcatatga aaatatatat ccatttattt atatttatat ttatattatc
8101 ttgcataaac attttataat atattttctt taatataact ttcccatata cgtacacaca tatataaata tatagtatgt gtacatatct
8191 acttatttta ttgcatatta tatccccttt ttttctccaa tttttttttt ttatacatgt aaaagtcgaa aattcccatt tataataaac
8281 ttaggagaaa atatatatta ttaactagta gtggtgaata agctctttga agtctcaaaa caataaaatt taaatgtgca taaataagat
8371 tgtgaatacg caaaaatgca aataaatacg catattatca ttcatttctt aattatttag aaacggttcg aactgcttct aatcgtgtct
8461 taagacaaac ccacatctta tctcaaagtt tagcatttcg aagcttatta ttgtttctaa aacatctcaa cattttactt acaaactttg
8551 aatgaaaaaa aacaatttta taattatata ctaaccataa aaaaataaat acccaaaacg aataaaatat attatgtacc tattttaaat
8641 gcgtttatac ccaaattttc gaaccacaat ttttatatga acatgttaat tttatttcac gtccccattt tatatatata aaattttttt
8731 cctatttctt attaccttta atattattta tactagatac agaaataatt taaaaggtac tatttaaaaa tgtgttacca ttttatttaa
8821 ctcacaagcc cctttattat attaaattta aaagcttatt ttatgagggt ttatataaaa attcattcgg ttttaaatgt aaatatatat
8911 atgcacataa ttttgtataa ataaaacata tatatacatt ataattattt atttgacagt tttgaaggat ttatgaaaag gaaaaattta
9001 tcatgtgtat atatgttttt atattttatt gacaagaaat tataaagctc ggaaaattaa tagaaaagta ggtgcaagca tgcacatata
9091 aatacattaa acaccaaaat acttttccaa tgacttgcct acatgtcttt gtacatataa tacatacata gtataataaa atatgaagct
9181 tttaaattat aataaatttt tatcttcatc ggtataaggt tcagatgcag gggcgttatc ttcctcatta gtataagaac cttttgtttc
9271 atcatcatca ttattatctt cggtacttaa tctgtttaaa tatgatatct ttataaatga agcaatacca catttttaca caaatatatt
9361 acatttttta tgtattgcat atgtgaaatg tatgagtgat ataatatggt agacatgaat aggctaaaac atagataaaa ccgaactaaa
9451 caaataaata taggaaaata ccccaatacg aatatttgta acattaaaaa ttaaaaagac acactttaat taaataaaat agagacgtga
9541 ataaaaatgt atttataata aaagtacgta aaaagaaagc gttaccaaaa cataaatgat ttttttctaa ctaaataaaa ttgcatatgt
9631 gaaggtataa tattttccta cataaaatgg cgtttattgg ttttttaata tgttttactt cattttgatt tattacacat atataaattt
9721 tttacaaaat tacgccatta atatagacat ttttaagaat gttgtattta ttgatcatat tcgaactaaa ttccgttgta aattcactca
9811 ggtgcatgca aaagatgcgg tatttttttg tactattaaa aatttatata tacaataatt gttcaaaata cataattttt tttaagcatt
9901 ttacaaacac aaataatttt ttcaaaataa aataaattgt tacgtatctc gaaaatagtg tatttaatat tatacaaatg taagggcaat
9991 acatatatat atatttattt atttaaaaga caatttataa atgcatatta ttcataaatt tttataatat ttctcgataa ttttgttcgc
10081 aatttgatgg tgacccctta tacatttgaa tttgctttaa aaatattaaa aaggaaaatt tttttttgtt atatagagtc atcatgcttg
10171 attattttat ttctgaattt aatttatcct catgtattta ttataacaat acgacgtgaa gttaaaacac cagttgcatt gatcaattta
10261 aaattttgat aaaaagtatt taaaaataaa aggtttataa ataggggctt attcatttat atttcttttt attatatttt ctttatattt
10351 ttcaacaaat atttataatt cgtaattttt tcgtcaattt aatatatttg cctttaagtt tttcgtaaat tacacttcag taataataat
10441 aaagctacat tttatagtgc gcattgttaa gcatataatc gataggactt ttaatatata ttttgttttt acacaaaata agaagaaggt
10531 ccctacattt ttttcgttaa aaaggaaatc tcaataatat taaattgtgt gtaatttttt ttgatgtata caaatatgac gtgtatatac
10621 gcaaaggtgc ttgtaaaaca aatggtatta agctgtgtgg tcacatttgt agttacatag caattatata tatatcattt ctaattttaa
10711 ttcaatttaa tttcggtatt aactatgcat ataaacatat tgttattatt atcttgccta tcataataaa ttttgtgtct atatagaaat
10801 gtattatcta ttttttagcg aagtagcata agtattattt atattcaaag aaataaataa aggtattaaa attaatacga aaataaaaat
10891 taaaggatga tggcgattat tagttctttt taattccatc atctatcctt atatgtagta tattggggtt agagatagtg ggttatgaat
10981 accaaaaata tagaaaattg caaaggagtt gatttattct ctgttgtata agaatgtaca cagttaaagt tagtatatat gtgtatattt
11071 ttcagtctat ataaatatac ttttgttttc tcattggtat gttcaatttt ttatattatt ttacgtgtcg atggatacaa tttagtattt
11161 tttttaattt tgtatttttg aattatatta atctagatta ttcatatatt ttttcatatg cagatagaaa aaggtttcat acgttagttt
11251 atcctacaaa ttgaatatta acacatacat atatttatat tttttattaa tagaaggatc caaaatgagt agatcttcta agaacgtcat
11341 caaggaattc atgagattca aggttaaaat ggaaggtact gttaacggcc acgaattcga aatcgaaggt gaaggtgagg gtagaccata
11431 tgaaggtcac aacacagtca agttgaaggt tactaagggt ggtccactgc cattcgcttg ggacatcttg tctccacaat tccaatacgg
11521 ttctaaggtc tacgtcaagc acccagctga cattccagac tacaagaagt tgtccttccc agaaggtttc aagtgggaaa ggatcatgaa
11611 cttcgaagac ggtggcgttg ttactgttac tcaagactcc tccttgcaag acggttgttt catctacaag gtcaagctca ttggtgtcaa
11701 cttcccatct gacggtccag tcatgcaaaa gaagactatg ggttgggaag cttctaccga acgtttgtac ccaagagacg gtgtcttgaa
11791 gggtgaaatc cacaaggcct tgaagttgaa ggacggtggt cactacttgg tcgaattcaa gtctatctac aaggccaaga agcaagtcca
11881 attgccaggc tattactacg ttgactctaa gttggacatc atctctcaca acgaagacta cactatcgtc gaacaatacg aacgtactga
11971 aggtagacac cacttgttct tgtaaactag ttctagaagt agtgtgtagc gtattctttt attttacaga aaatgtatat tatcattttt
12061 cgcatttcat cgtttaaaca agtacatgaa cgtgtgcatg caattatttc tgtgtttgga tttgtattca aatcatcatg aacttttttt
12151 gaatattcgt tacaagccat aatagaatat acaccatcta caatataatt tttttttcac tattttatat ttcatcctat tgtgtatgta
12241 tattccttta ataaaaaatc catatgctta acattcacat atattaataa ttttaattaa tttttttttt tgcacagata aaacttttct
12331 ttttaaaaaa aaggtatata cactcttttt taccccacat ttaactgatt ttcactcacc attacatata gctatatatt gcatattact
12421 attatgtaag gcaaatgttt attattattg ctgttatttt ttatttatat atttttttcc atatatcaat ttaaggagaa ataaaataat
12511 ttgctatttg aaaaaatata aaacaaatat ctagtcgtgc aatactgaat tcgaatactt aaaacaaaaa ataaattaat taaataccct
12601 tttaatattg tagttaaaat cgatgtgttt agagaatatt ttttattgct atttatcttc ttttttttat ttttcttcca tgttttctca
12691 ttcagctttc tatgtatttt agtaatattc tccacacaca aactataaat tttcttatga aaaatcacaa aatttagcaa atagcgctta
12781 ggcatgtact cgtaaataag catgtgcata gtataataca cttctcatca attttgagag gattttattt aatttcggca cgcccctctc
12871 aacttgtgtt tatcacatat tcaatactcc ataaaaaatg atagcatcat ttcgatatgc gggtaccgag ctcgaattct cttgagcccg
12961 ttaatgaaat agatacaatt cattcatgtt atatacatct agaacataat ctgaatatgg ttcaagttaa atgtccaaaa attataaaaa
13051 gtgatgatat ttttgatggt aataccataa tagacaccaa ggtaacatca cgaagtagtc aacaaaataa tttttattta gaaaatacag
13141 atgttgaacc agaagaaata gagaaatata aaaatataga atacatacca gaaaacgatg aagtaatgca tctagacaaa aaagaaaagc
13231 tagatgatat attaccaggt gttatcatat tagataaaaa taaaatgttc aaagaaaaag gacatttcac ttttgttact ccattaattg
13321 tagaaaaggt attaatatta aaaatatatt gtgataatac taaaacaata attaataata tgaaagggaa aaaaggtatt acagtaataa
13411 ggatttctca aaatacaaca aaaaataaat tttatggatg tgacttttca ggtaattcta aaaaaacatt ttactattcc aatgtttatg
13501 atttagaaaa aaaaaatgag ttttgtgaaa tagaattaaa agaaaatata gtagttagct taaattgtcc aactggtaaa attaatccaa
13591 aaaattgttt tagaaatgta tatataaaaa gtaatatgaa tgaacaaaca accgaaaata tagaaaatat atttaacgaa ataaaagtta
13681 tagatgcaga ttattttata aataattcat caaccttttt gatgatttcc aaaattacaa aaaaagagtt tgatttttat tgtacatgtg
13771 aagattataa aaccaaaaat ataggaacaa tatatattaa aaattatgaa tatctagatt caaaacctaa atataaaaat aaacaaattt
13861 cctatataga tgtagttcca tacccgcggg gaaagggcg
Restriction sites to linearize plasmid SacII
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1319500
Gene Model P. falciparum ortholog PF3D7_1455800
Gene productLCCL domain-containing protein
Gene product: Alternative nameLAP4; LCCL/lectin adhesive-like protein 4; CCp2
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_1359600
Gene producttransmission blocking target antigen precursor 6-cysteine protein
Gene product: Alternative nameP48/45
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 13’-cggGGTACCCGCATATCGAAATGATGCTATC
Additional information primer 13’utr of the p48/45 gene (PB001525.02.0; 3’48/45; Asp718/XbaI; 1882
Sequence Primer 23’- gcTCTAGAAGTAGTGTGTAGCGTATTC
Additional information primer 23’utr of the p48/45 gene (PB001525.02.0; 3’48/45; Asp718/XbaI;1881
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15'-cccaagcttccgcgggtatatggtaaagaacctactaacac
Additional information primer 1primer L1345: 0.7kb 5'region of PB000214.00.0 (230p gene)
Sequence Primer 25'-cccaagcttgatgtgttttatttggatgtgc
Additional information primer 2primer L1346: 0.7kb 5'region of PB000214.00.0 (230p gene)
Sequence Primer 35'-ccggaattctcttgagcccgttaatg
Additional information primer 3primer L1347: 1kb 3'region of PB000214.00.0 (230p gene)
Sequence Primer 45'-tccccgcgggtatggaactacatctatatagg
Additional information primer 4primer L1348: 1kb 3'region of PB000214.00.0 (230p gene)

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mut3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc
91 agctggcgta atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat ggcgcctgat gcggtatttt
181 ctccttacgc atctgtgcgg tatttcacac cgcatatggt gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga
271 cacccgccaa cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc cgggagctgc
361 atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata
451 ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg
541 tatccgctca tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt
631 attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca
721 cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt
811 aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
901 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac
991 actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt
1081 gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa
1171 ctattaactg gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc
1261 tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat
1351 ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc
1441 tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc
1531 taggtgaaga tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc
1621 aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg
1711 gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg
1891 tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg
1981 gagcgaacga cctacaccga actgagatac ctacagcgtg agcattgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat
2071 ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc
2161 cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc
2251 ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct
2341 gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc
2431 gcgcgttggc cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tgtgagttag
2521 ctcactcatt aggcacccca ggctttacac tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga
2611 aacagctatg accatgatta cgccaagctt ccgcgggtat atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct
2701 ataaataaat ttacagattt attttttaat acaaaagata tagatatacc agaaataaat gatcagttta aaggttttaa attctttatg
2791 acatcattta taaatcatgg atcatatcca ctaacaatag aatgtggtgt aacaaatggt ggaactagtt ataaaagagc aattatttta
2881 ttgcatgttc gaactgattt aaaagataga ccagtttcat tttgtgattt tcgaaaagga gaattatata attatttgaa tgcttatact
2971 gaaggggatg tatgcataat aatttccaaa tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc aaaaaattgt
3061 tttacgcaag tatatgaaaa agggtatcta aatgacgcca ataaaattaa tactaaaaat gttattaact attcatttga aaatccagaa
3151 tatgcgctag ctggttytaa ttatacatta acaaaatcgt atcaatttga atgtcattgt gtagataaag aaacagaaca aattgtaaaa
3241 acggttttag tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg gtgaatcaca aacctattat tgcacatcca
3331 aataaaacac atcaagcttg catgcctgca ggaattcgat ggccgctcta gctttgatcc cgtttttctt acttatatat ttataccaat
3421 tgattgtatt tataactgta aaaatgtgta tgttgtgtgc atattttttt ttgtgcatgc acatgcatgt aaatagctaa aattatgaac
3511 attttatttt ttgttcagaa aaaaaaaact ttacacacat aaaatggcta gtatgaatag ccatatttta tataaattaa atcctatgaa
3601 tttatgacca tattaaaaat ttagatattt atggaacata atatgtttga aacaataaga caaaattatt attattatta ttatttttac
3691 tgttataatt atgttgtctc ttcaatgatt cataaatagt tggacttgat ttttaaaatg tttataatat gattagcata gttaaataaa
3781 aaaagttgaa aaattaaaaa aaaacatata aacacaaatg atgttttttc cttcaatttc gattgataat tatgcagccc agcttaattc
3871 ttttcgagct ctttatgctt aagtttacaa tttaatattc atactttaag tattttttgt agtatcctag atattgtgct ttaaatgctc
3961 acccctcaaa gcaccagtaa tattttcatc cactgaaata ccattaaatt ttcaaaaaaa tactatgcat ataatgttat acatataaac
4051 ataaaacgcc atgtaaatca aaaaatatat aaaaatatgt ataaaaataa atatgcacta aatataagct aattatgcat aaaaattaaa
4141 gtgcccttta ttaactagaa ctagtcgtaa ttatttatat ttctatgtta taaaaaaatc ctcatataat aatataatta atatatgtaa
4231 tgtttttttt attttataat tttaatataa aataatatgt aaattaattc aaaaaataaa tataattgtt gtgaaacaaa aaacgtaatt
4321 ttttcatttg ccttcaaaat ttaaatttat tttaatattt cctaaaatat atatactttg tgtataaata tataaaaata tatatttgct
4411 tataaataaa taaaaaattt tataaaacat agggggatcc atggttggtt cgctaaactg catcgtcgct gtgtcccaga acatgggcat
4501 cggcaagaac ggggacctgc cctggccacc gctcaggaac gaatttagat atttccagag aatgaccaca acctcttcag tagaaggtaa
4591 acagaatctg gtgattatgg gtaagaagac ctggttctcc attcctgaga agaatcgacc tttaaagggt agaattaatt tagttctcag
4681 cagagaactc aaggaacctc cacaaggagc tcattttctt tccagaagtc tagatgatgc cttaaaactt actgaacaac cagaattagc
4771 aaataaagta gacatggtct ggatagttgg tggcagttct gtttataagg aagccatgaa tcacccaggc catcttaaac tatttgtgac
4861 aaggatcatg caagactttg aaagtgacac gttttttcca gaaattgatt tggagaaata taaacttctg ccagaatacc caggtgttct
4951 ctctgatgtc caggaggaga aaggcattaa gtacaaattt gaagtatatg agaagaatga tgctagcgga ggaggtggat ctggtggagg
5041 tggaagtgct agcgtgacag ggggaatggc aagcaagtgg gatcagaagg gtatggacat tgcctatgag gaggcggcct taggttacaa
5131 agagggtggt gttcctattg gcggatgtct tatcaataac aaagacggaa gtgttctcgg tcgtggtcac aacatgagat ttcaaaaggg
5221 atccgccaca ctacatggtg agatctccac tttggaaaac tgtgggagat tagagggcaa agtgtacaaa gataccactt tgtatacgac
5311 gctgtctcca tgcgacatgt gtacaggtgc catcatcatg tatggtattc cacgctgtgt tgtcggtgag aacgttaatt tcaaaagtaa
5401 gggcgagaaa tatttacaaa ctagaggtca cgaggttgtt gttgttgacg atgagaggtg taaaaagatc atgaaacaat ttatcgatga
5491 aagacctcag gattggtttg aagatattgg tgaggcttcg gaaccattta agaacgtcta cttgctacct caaacaaacc aattgctggg
5581 tttgtacacc atcatcagaa ataagaatac aactagacct gatttcattt tctactccga tagaatcatc agattgttgg ttgaagaagg
5671 tttgaaccat ctacctgtgc aaaagcaaat tgtggaaact gacaccaacg aaaacttcga aggtgtctca ttcatgggta aaatctgtgg
5761 tgtttccatt gtcagagctg gtgaatcgat ggagcaagga ttaagagact gttgtaggtc tgtgcgtatc ggtaaaattt taattcaaag
5851 ggacgaggag actgctttac caaagttatt ctacgaaaaa ttaccagagg atatatctga aaggtatgtc ttcctattag acccaatgct
5941 ggccaccggt ggtagtgcta tcatggctac agaagtcttg attaagagag gtgttaagcc agagagaatt tacttcttaa acctaatctg
6031 tagtaaggaa gggattgaaa aataccatgc cgccttccca gaggtcagaa ttgttactgg tgccctcgac agaggtctag atgaaaacaa
6121 gtatctagtt ccagggttgg gtgactttgg tgacagatac tactgtgttt aactcgatcc cgtttttctt acttatatat ttataccaat
6211 tgattgtatt tataactgta aaaatgtgta tgttgtgtgc atattttttt ttgtgcatgc acatgcatgt aaatagctaa aattatgaac
6301 attttatttt ttgttcagaa aaaaaaaact ttacacacat aaaatggcta gtatgaatag ccatatttta tataaattaa atcctatgaa
6391 tttatgacca tattaaaaat ttagatattt atggaacata atatgtttga aacaataaga caaaattatt attattatta ttatttttac
6481 tgttataatt atgttgtctc ttcaatgatt cataaatagt tggacttgat ttttaaaatg tttataatat gattagcata gttaaataaa
6571 aaaagttgaa aaattaaaaa aaaacatata aacacaaatg atgttttttc cttcaatttc gggtaccgac catataagaa ttaacccttt
6661 acttttttcg tatttttcat taacttccat ttgttaattt tttaaaataa gtttttattt tcaataaaaa aactatatta atttaatcta
6751 attataagca aaaaattaaa ttcaaagaat aaaattatat gcacataatg tgtgcccctt taaaacaaat attcgatgtt taattcgtac
6841 tttatgctaa ttttttatta ttcacagatt ttatattaga gttataaaaa tttagaattt tttcaagtaa aatattatta gttaatggca
6931 ttaaaatgta taaggaaaag ttaatataaa aattaaaaaa aacagttaca cgtatattac gcatacaacg atgtatatat attcatatat
7021 attaataatt ctagagtcgc ggccgcttta cttgtacagc tcgtccatgc cgagagtgat cccggcggcg gtcacgaact ccagcaggac
7111 catgtgatcg cgcttctcgt tggggtcttt gctcagggcg gactgggtgc tcaggtagtg gttgtcgggc agcagcacgg ggccgtcgcc
7201 gatgggggtg ttctgctggt agtggtcggc gagctgcacg ctgccgtcct cgatgttgtg gcggatcttg aagttcacct tgatgccgtt
7291 cttctgcttg tcggccatga tatagacgtt gtggctgttg tagttgtact ccagcttgtg ccccaggatg ttgccgtcct ccttgaagtc
7381 gatgcccttc agctcgatgc ggttcaccag ggtgtcgccc tcgaacttca cctcggcgcg ggtcttgtag ttgccgtcgt ccttgaagaa
7471 gatggtgcgc tcctggacgt agccttcggg catggcggac ttgaagaagt cgtgctgctt catgtggtcg gggtagcggc tgaagcactg
7561 cacgccgtag gtcagggtgg tcacgagggt gggccagggc acgggcagct tgccggtggt gcagatgaac ttcagggtca gcttgccgta
7651 ggtggcatcg ccctcgccct cgccggacac gctgaacttg tggccgttta cgtcgccgtc cagctcgacc aggatgggca ccaccccggt
7741 gaacagctcc tcgcccttgc tcaccatggt ggcgaccggt ggatcctttt tatcatttgg ataattaatt cttatattta ttctgaatta
7831 aatcaaactt cctattcata tgtacatgca tctatatgta tgaaatacat ataatactac tatataccac caaattacat atccaaataa
7921 cttgtgccct taacactgca tatatatgtt tgtccatata tttgcaaata tctatatata ctataaacct tatgcacaaa cccctttttc
8011 gcatataaaa atgaatatat atatatatat atatatatac tgtcatatga aaatatatat ccatttattt atatttatat ttatattatc
8101 ttgcataaac attttataat atattttctt taatataact ttcccatata cgtacacaca tatataaata tatagtatgt gtacatatct
8191 acttatttta ttgcatatta tatccccttt ttttctccaa tttttttttt ttatacatgt aaaagtcgaa aattcccatt tataataaac
8281 ttaggagaaa atatatatta ttaactagta gtggtgaata agctctttga agtctcaaaa caataaaatt taaatgtgca taaataagat
8371 tgtgaatacg caaaaatgca aataaatacg catattatca ttcatttctt aattatttag aaacggttcg aactgcttct aatcgtgtct
8461 taagacaaac ccacatctta tctcaaagtt tagcatttcg aagcttatta ttgtttctaa aacatctcaa cattttactt acaaactttg
8551 aatgaaaaaa aacaatttta taattatata ctaaccataa aaaaataaat acccaaaacg aataaaatat attatgtacc tattttaaat
8641 gcgtttatac ccaaattttc gaaccacaat ttttatatga acatgttaat tttatttcac gtccccattt tatatatata aaattttttt
8731 cctatttctt attaccttta atattattta tactagatac agaaataatt taaaaggtac tatttaaaaa tgtgttacca ttttatttaa
8821 ctcacaagcc cctttattat attaaattta aaagcttatt ttatgagggt ttatataaaa attcattcgg ttttaaatgt aaatatatat
8911 atgcacataa ttttgtataa ataaaacata tatatacatt ataattattt atttgacagt tttgaaggat ttatgaaaag gaaaaattta
9001 tcatgtgtat atatgttttt atattttatt gacaagaaat tataaagctc ggaaaattaa tagaaaagta ggtgcaagca tgcacatata
9091 aatacattaa acaccaaaat acttttccaa tgacttgcct acatgtcttt gtacatataa tacatacata gtataataaa atatgaagct
9181 tttaaattat aataaatttt tatcttcatc ggtataaggt tcagatgcag gggcgttatc ttcctcatta gtataagaac cttttgtttc
9271 atcatcatca ttattatctt cggtacttaa tctgtttaaa tatgatatct ttataaatga agcaatacca catttttaca caaatatatt
9361 acatttttta tgtattgcat atgtgaaatg tatgagtgat ataatatggt agacatgaat aggctaaaac atagataaaa ccgaactaaa
9451 caaataaata taggaaaata ccccaatacg aatatttgta acattaaaaa ttaaaaagac acactttaat taaataaaat agagacgtga
9541 ataaaaatgt atttataata aaagtacgta aaaagaaagc gttaccaaaa cataaatgat ttttttctaa ctaaataaaa ttgcatatgt
9631 gaaggtataa tattttccta cataaaatgg cgtttattgg ttttttaata tgttttactt cattttgatt tattacacat atataaattt
9721 tttacaaaat tacgccatta atatagacat ttttaagaat gttgtattta ttgatcatat tcgaactaaa ttccgttgta aattcactca
9811 ggtgcatgca aaagatgcgg tatttttttg tactattaaa aatttatata tacaataatt gttcaaaata cataattttt tttaagcatt
9901 ttacaaacac aaataatttt ttcaaaataa aataaattgt tacgtatctc gaaaatagtg tatttaatat tatacaaatg taagggcaat
9991 acatatatat atatttattt atttaaaaga caatttataa atgcatatta ttcataaatt tttataatat ttctcgataa ttttgttcgc
10081 aatttgatgg tgacccctta tacatttgaa tttgctttaa aaatattaaa aaggaaaatt tttttttgtt atatagagtc atcatgcttg
10171 attattttat ttctgaattt aatttatcct catgtattta ttataacaat acgacgtgaa gttaaaacac cagttgcatt gatcaattta
10261 aaattttgat aaaaagtatt taaaaataaa aggtttataa ataggggctt attcatttat atttcttttt attatatttt ctttatattt
10351 ttcaacaaat atttataatt cgtaattttt tcgtcaattt aatatatttg cctttaagtt tttcgtaaat tacacttcag taataataat
10441 aaagctacat tttatagtgc gcattgttaa gcatataatc gataggactt ttaatatata ttttgttttt acacaaaata agaagaaggt
10531 ccctacattt ttttcgttaa aaaggaaatc tcaataatat taaattgtgt gtaatttttt ttgatgtata caaatatgac gtgtatatac
10621 gcaaaggtgc ttgtaaaaca aatggtatta agctgtgtgg tcacatttgt agttacatag caattatata tatatcattt ctaattttaa
10711 ttcaatttaa tttcggtatt aactatgcat ataaacatat tgttattatt atcttgccta tcataataaa ttttgtgtct atatagaaat
10801 gtattatcta ttttttagcg aagtagcata agtattattt atattcaaag aaataaataa aggtattaaa attaatacga aaataaaaat
10891 taaaggatga tggcgattat tagttctttt taattccatc atctatcctt atatgtagta tattggggtt agagatagtg ggttatgaat
10981 accaaaaata tagaaaattg caaaggagtt gatttattct ctgttgtata agaatgtaca cagttaaagt tagtatatat gtgtatattt
11071 ttcagtctat ataaatatac ttttgttttc tcattggtat gttcaatttt ttatattatt ttacgtgtcg atggatacaa tttagtattt
11161 tttttaattt tgtatttttg aattatatta atctagatta ttcatatatt ttttcatatg cagatagaaa aaggtttcat acgttagttt
11251 atcctacaaa ttgaatatta acacatacat atatttatat tttttattaa tagaaggatc caaaatgagt agatcttcta agaacgtcat
11341 caaggaattc atgagattca aggttaaaat ggaaggtact gttaacggcc acgaattcga aatcgaaggt gaaggtgagg gtagaccata
11431 tgaaggtcac aacacagtca agttgaaggt tactaagggt ggtccactgc cattcgcttg ggacatcttg tctccacaat tccaatacgg
11521 ttctaaggtc tacgtcaagc acccagctga cattccagac tacaagaagt tgtccttccc agaaggtttc aagtgggaaa ggatcatgaa
11611 cttcgaagac ggtggcgttg ttactgttac tcaagactcc tccttgcaag acggttgttt catctacaag gtcaagctca ttggtgtcaa
11701 cttcccatct gacggtccag tcatgcaaaa gaagactatg ggttgggaag cttctaccga acgtttgtac ccaagagacg gtgtcttgaa
11791 gggtgaaatc cacaaggcct tgaagttgaa ggacggtggt cactacttgg tcgaattcaa gtctatctac aaggccaaga agcaagtcca
11881 attgccaggc tattactacg ttgactctaa gttggacatc atctctcaca acgaagacta cactatcgtc gaacaatacg aacgtactga
11971 aggtagacac cacttgttct tgtaaactag ttctagaagt agtgtgtagc gtattctttt attttacaga aaatgtatat tatcattttt
12061 cgcatttcat cgtttaaaca agtacatgaa cgtgtgcatg caattatttc tgtgtttgga tttgtattca aatcatcatg aacttttttt
12151 gaatattcgt tacaagccat aatagaatat acaccatcta caatataatt tttttttcac tattttatat ttcatcctat tgtgtatgta
12241 tattccttta ataaaaaatc catatgctta acattcacat atattaataa ttttaattaa tttttttttt tgcacagata aaacttttct
12331 ttttaaaaaa aaggtatata cactcttttt taccccacat ttaactgatt ttcactcacc attacatata gctatatatt gcatattact
12421 attatgtaag gcaaatgttt attattattg ctgttatttt ttatttatat atttttttcc atatatcaat ttaaggagaa ataaaataat
12511 ttgctatttg aaaaaatata aaacaaatat ctagtcgtgc aatactgaat tcgaatactt aaaacaaaaa ataaattaat taaataccct
12601 tttaatattg tagttaaaat cgatgtgttt agagaatatt ttttattgct atttatcttc ttttttttat ttttcttcca tgttttctca
12691 ttcagctttc tatgtatttt agtaatattc tccacacaca aactataaat tttcttatga aaaatcacaa aatttagcaa atagcgctta
12781 ggcatgtact cgtaaataag catgtgcata gtataataca cttctcatca attttgagag gattttattt aatttcggca cgcccctctc
12871 aacttgtgtt tatcacatat tcaatactcc ataaaaaatg atagcatcat ttcgatatgc gggtaccgag ctcgaattct cttgagcccg
12961 ttaatgaaat agatacaatt cattcatgtt atatacatct agaacataat ctgaatatgg ttcaagttaa atgtccaaaa attataaaaa
13051 gtgatgatat ttttgatggt aataccataa tagacaccaa ggtaacatca cgaagtagtc aacaaaataa tttttattta gaaaatacag
13141 atgttgaacc agaagaaata gagaaatata aaaatataga atacatacca gaaaacgatg aagtaatgca tctagacaaa aaagaaaagc
13231 tagatgatat attaccaggt gttatcatat tagataaaaa taaaatgttc aaagaaaaag gacatttcac ttttgttact ccattaattg
13321 tagaaaaggt attaatatta aaaatatatt gtgataatac taaaacaata attaataata tgaaagggaa aaaaggtatt acagtaataa
13411 ggatttctca aaatacaaca aaaaataaat tttatggatg tgacttttca ggtaattcta aaaaaacatt ttactattcc aatgtttatg
13501 atttagaaaa aaaaaatgag ttttgtgaaa tagaattaaa agaaaatata gtagttagct taaattgtcc aactggtaaa attaatccaa
13591 aaaattgttt tagaaatgta tatataaaaa gtaatatgaa tgaacaaaca accgaaaata tagaaaatat atttaacgaa ataaaagtta
13681 tagatgcaga ttattttata aataattcat caaccttttt gatgatttcc aaaattacaa aaaaagagtt tgatttttat tgtacatgtg
13771 aagattataa aaccaaaaat ataggaacaa tatatattaa aaattatgaa tatctagatt caaaacctaa atataaaaat aaacaaattt
13861 cctatataga tgtagttcca tacccgcggg gaaagggcg
Restriction sites to linearize plasmid SacII
Selectable marker used to select the mutant parasitehdhfr/yfcu
Promoter of the selectable markereef1a
Selection (positive) procedurepyrimethamine
Selection (negative) procedure5-fluorocytosine (5-FC)
Additional remarks genetic modification
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0416100
Gene Model P. falciparum ortholog PF3D7_0905300
Gene productdynein heavy chain, putative
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_1010600
Gene productcalmodulin, putative
Gene product: Alternative namecam
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1tgcTCTAGAATTATTAATATATATGAATATATATACATCGTTGTATGCG
Additional information primer 12566, Asp718
Sequence Primer 2cggGGTACCGACCATATAAGAATTAACCC
Additional information primer 22576, XbaI
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15'-cccaagcttccgcgggtatatggtaaagaacctactaacac
Additional information primer 1primer L1345: 0.7kb 5'region of PB000214.00.0 (230p gene)
Sequence Primer 25'-cccaagcttgatgtgttttatttggatgtgc
Additional information primer 2primer L1346: 0.7kb 5'region of PB000214.00.0 (230p gene)
Sequence Primer 35'-ccggaattctcttgagcccgttaatg
Additional information primer 3primer L1347: 1kb 3'region of PB000214.00.0 (230p gene)
Sequence Primer 45'-tccccgcgggtatggaactacatctatatagg
Additional information primer 4primer L1348: 1kb 3'region of PB000214.00.0 (230p gene)