Summary

RMgm-618
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1211900; Gene model (P.falciparum): PF3D7_1013500; Gene product: phosphoinositide-specific phospholipase C (PI-PLC)
PhenotypeNo phenotype has been described
Last modified: 21 December 2011, 15:56
  *RMgm-618
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 3
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21651909
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943)
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherA.C. Raabe; O. Billker; K. Wengelnik
Name Group/DepartmentUMR5235, CNRS
Name InstituteUniversité Montpellier 2
CityMontpellier
CountryFrance

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1211900
Gene Model P. falciparum ortholog PF3D7_1013500
Gene productphosphoinositide-specific phospholipase C
Gene product: Alternative namePI-PLC
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPhosphoinositide-specific phospholipase C (PI-PLC) is a major regulator of calcium-dependent signal transduction, which has been shown to be important in various processes of malaria parasites. PI-PLC is generally implicated in calcium liberation from intracellular stores through the action of its product, inositol-(1,4,5)-trisphosphate, and is itself dependent on calcium for its activation. The Plasmodium protein contains all domains typically found in PI-PLCs of the delta class but is almost twice as long as their orthologues in mammals.

The negative attempts to disrupt the gene indicates an essential role of PI-PLC during asexual blood stage growth and multiplication.

In addition to attempts to disrupt the Pbplc locus by double cross-over homologius recombination, the Pbplc locus was targeted by single homologous recombination in the beginning of the plc open reading frame. The hdhfr resistance cassette would in this way be inserted into the plc coding sequence after amino acid 368, upstream of the X and Y catalytic domains. However, in three independent experiments this construct did not yield viable knock-out parasites either indicating that either PI-PLC was essential during blood stage development or the locus was refractory to recombination. A promoter exchange strategy was chosen that would prove that the plc locus could be targeted by genetic modification and, at the same time, might allow modification of the plc expression level. The targeting vector was designed based on the single cross-over knock-out construct described above. By placing an alternative promoter in front of the homology region needed for recombination, integration of the construct places a new promoter in front the plc coding sequence.

The expression profile of the cGMP-dependent protein kinase gene (pkg; PF14_0346; PBANKA_100820) resembles the one of plc in P. falciparum. The pkg promoter was therefore used for a ‘proof of principle’ approach. Upon transfection pyrimethamine resistant parasites were obtained and were cloned by limiting dilution. PCR analysis indicated that the construct had integrated correctly into the genome, thereby demonstrating that the plc locus was generally available for recombination and that the promoter replacement itself was possible. Thus, the inability to obtain plc knock-out parasites is most likely due the fact that PI-PLC activity is essential during asexual erythrocytic development.

However, in an attempt to over-express the plc gene by using the strong promoter of the elongation factor-1alpha gene (ef1a) no parasites were obtained with correct integration in three independent transfections, suggesting that over-expression of plc was not supported by the parasite. In addition, several other promoter exchange constructs also did not integrate into the genome (data not shown) indicating that plc expression might me tightly regulated by the parasite

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565).
The gene is likely essential for asexual proliferation as integration of the KO vector was not achieved. Accesibility of the locus to recombination was verified by C-terminal tagging.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1GGTACCACTATGTATGCATGAAGCG
Additional information primer 15' targeting region Fw (KpnI)
Sequence Primer 2GGGCCCCATGAGGAACGCAAAAAACAC
Additional information primer 25' targeting region Rv (ApaI)
Sequence Primer 3GAATTCTTAAAGATTGTGAGATTATGTATG
Additional information primer 33' targeting region Fw (EcoRI)
Sequence Primer 4GGATCCTGAAGA CATTCAAATGCC
Additional information primer 43' targeting region Rv (BamHI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6