RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-617
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0719200; Gene model (P.falciparum): PF3D7_0417100; Gene product: mRNA-binding protein PUF2 (Pumilio2)
Transgene
Transgene not Plasmodium: GFP (gfp-mu3)
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_0306000; Gene product: 6-cysteine protein (230p)
Phenotype Gametocyte/Gamete; Sporozoite; Liver stage;
Last modified: 21 December 2011, 16:29
  *RMgm-617
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21673790
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 507cl1 (RMgm-7)
Other information parent lineRMgm-7 is a P.berghei ANKA line (507cl1) which expresses GFP under control of a constitutive promoter (PubMed: PMID: 16242190).
The mutant parasite was generated by
Name PI/ResearcherK. Müller; K. Matuschewski; O. Silvie
Name Group/DepartmentParasitology Unit
Name InstituteMax Planck Institute for Infection Biology
CityBerlin
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-617
Principal namepuf2(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteIncreased numbers of (male) gametocytes
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of oocysts and salivary gland sporozoites are formed. Sporozoites show a strongly reduced infectivity to mice both after intravenous inoculation of sporozoites or after infection by mosquito bite. Sporozoites showed normal invasion of HepG2 cells in vitro. However, both in vivo and in vitro liver stage development was strongly affected.
Liver stageNormal numbers of oocysts and salivary gland sporozoites are formed. Sporozoites show a strongly reduced infectivity to mice both after intravenous inoculation of sporozoites or after infection by mosquito bite. Sporozoites showed normal invasion of HepG2 cells in vitro. However, both in vivo and in vitro liver stage development was strongly affected.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of the RNA binding protein Puf2 and expresses GFP under the constitutive eef1α promoter.

Protein (function)
The roles of Puf (Pumilio and fem-3 mRNA binding factor) proteins are diverse yet intimately involved in the translational regulation of developmental and differentiation factors in organisms as diverse as yeast, C. elegans, Drosophila and humans. Two such proteins, Puf1 (PFE0935c) and Puf2 (PFD0825c), are known in the human malaria parasite, P. falciparum, with orthologs in all Plasmodium spp. characterized. The Plasmodium Puf proteins have the typical highly conserved organization that includes the eight tandem copies of the PUM RNA binding domain (or Pumilio Homology Domain, PHD) at the carboxyterminus of the protein and expectedly PfPuf2 was shown to bind RNA in vitro. In P. falciparum evidence has been reported for a role for Puf2 in gametocyte development although Pfpuf2 is most highly transcribed in sporozoites (see also 'Additional Information').

Phenotype
The phenotype analyses indicate that Puf2 is not essential for blood stage development, production of gametocytes, ookinetes, oocysts and sporozoites. However, sporozoite infectivity is affected. Evidence is presented that sporozoites in the absence of Puf2 'prematurely' initiate development into the early livers stage (EEF's) inside salivary glands (see below). The phenotype analyses indicate that the RNA binding protein Puf2 regulates the transition of sporozoites into liver stage forms.

Additional information
Evidence is presented that sporozoites in the absence of Puf2 'prematurely' initiate development into the early livers stage (EEF's) inside salivary glands. This is based on morphological changes of sporozoites in salivary glands, at day 18-27after mosquito infection, resembling transformation of sporozoites into the early liver stage after hepatocyte invasion.

Evidence is presented that mutant sporozoites have reduced levels of mRNA transcripts of the genes puf1 (PBANKA_123350) and uis1/ik2 (PBANKA_020580; PFA0380w).

Independent mutants lacking expression of Puf2 have been published (RMgm-515, RMgm-516, RMgm-591). A few aspects of the phenotype of these parasites are different from the mutants described here: i) no effect on gametocyte production was reported; ii) sporozoites showed reduced capacity to invade hepatocytes in vitro.

In P. falciparum Puf2 expression has been demonstrated in gametocytes and disruption of Pfpuf2 (PFD0825c) resulted in increased gametocyte production and increased differentiation of male gametocytes (Miao J. et al., 2010, 123-1039-1049). The phenotype of the P. falciparum mutants lacking expression of Puf2 has not been analysed during mosquito development.

See mutants RMgm-513, RMgm-514 and RMgm-616 for P. berghei mutants lacking expression of Puf1 ((PBANKA_123350) . Phenotype analyses of these mutants indicate  that Puf1 is not essential for blood stage development, production of gametocytes, ookinetes, oocysts and infective sporozoites and for mosquito transmission and liver stage development .

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565). After transfection with a KO vector a strong PCR signal diagnostic for gene disruption was observed in transfected populations indicating that this gene is not essential for asexual proliferation. Cloning will however be required to validate this interpretation for this

Other mutants
RMgm-616: mutant lacking expression of Puf 1((PBANKA_123350) which expresses GFP under the constitutive eef1α promoter
RMgm-513: A mutant lacking expression of Puf1 (PBANKA_123350)
RMgm-514: A mutant lacking expression of Puf1 (PBANKA_123350) which expresses GFP under the constitutive eef1α promoter
RMgm-515: An independent mutant lacking expression of Puf2
RMgm-516: An independent mutant lacking expression of Puf2 which expresses GFP under the constitutive eef1α promoter
RMgm-591: A mutant lacking expression of both Puf1 and Puf2 which expresses GFP under the constitutive eef1α promoter


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0719200
Gene Model P. falciparum ortholog PF3D7_0417100
Gene productmRNA-binding protein PUF2
Gene product: Alternative namePumilio2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1TCCCCGCGGGGATAAATAAATATAAGGTCTATAACAAG
Additional information primer 15´ fragment forward (KspI)
Sequence Primer 2ATAAGAATGCGGCCGCACATTTTCGTTTTGGGTATACTTAAATGTATATATGC
Additional information primer 25´ fragment reverse (NotI)
Sequence Primer 3CCCAAGCTTTATTTTAAGGGCTATTAATAATTTAGAGG
Additional information primer 33´ fragment forward (HindIII)
Sequence Primer 4CCGCTCGAGAGCTAATTAATTATAGTATGTCATGTAGAG
Additional information primer 43´ fragment reverse (XhoI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP (gfp-mu3)
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Click to view information
Click to hide information
Plasmid/construct sequence
Click to view information
Click to hide information
" 1 aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt
51 tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta
101 atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg
151 aatggcgaat ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg
201 tatttcacac cgcatatggt gcactctcag tacaatctgc tctgatgccg
251 catagttaag ccagccccga cacccgccaa cacccgctga cgcgccctga
301 cgggcttgtc tgctcccggc atccgcttac agacaagctg tgaccgtctc
351 cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga
401 gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata
451 ataatggttt cttagacgtc aggtggcact tttcggggaa atgtgcgcgg
501 aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca
551 tgagacaata accctgataa atgcttcaat aatattgaaa aaggaagagt
601 atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt
651 ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg
701 ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac
751 agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat
801 gagcactttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg
851 ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg
901 gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt
951 aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca
1001 acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg
1051 cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct
1101 gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa
1151 tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct
1201 tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc
1251 acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg
1301 gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat
1351 ggtaagccct cccgtatcgt agttatctac acgacgggga gtcaggcaac
1401 tatggatgaa cgaaatagac agatcgctga gataggtgcc tcactgatta
1451 agcattggta actgtcagac caagtttact catatatact ttagattgat
1501 ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga
1551 taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt
1601 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg
1651 cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt
1701 ttgtttgccg gatcaagagc taccaactct ttttccgaag gtaactggct
1751 tcagcagagc gcagatacca aatactgtcc ttctagtgta gccgtagtta
1801 ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct
1851 aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg
1901 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga
1951 acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga
2001 actgagatac ctacagcgtg agcattgaga aagcgccacg cttcccgaag
2051 ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag
2101 cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt
2151 cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag
2201 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc
2251 ctggcctttt gctggccttt tgctcacatg ttctttcctg cgttatcccc
2301 tgattctgtg gataaccgta ttaccgcctt tgagtgagct gataccgctc
2351 gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa
2401 gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta
2451 atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca
2501 acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac
2551 tttatgcttc cggctcgtat gttgtgtgga attgtgagcg gataacaatt
2601 tcacacagga aacagctatg accatgatta cgccaagctt ccgcgggtat
2651 atggtaaaga acctactaac acaataaaat atttaaataa tgtatttcct
2701 ataaataaat ttacagattt attttttaat acaaaagata tagatatacc
2751 agaaataaat gatcagttta aaggttttaa attctttatg acatcattta
2801 taaatcatgg atcatatcca ctaacaatag aatgtggtgt aacaaatggt
2851 ggaactagtt ataaaagagc aattatttta ttgcatgttc gaactgattt
2901 aaaagataga ccagtttcat tttgtgattt tcgaaaagga gaattatata
2951 attatttgaa tgcttatact gaaggggatg tatgcataat aatttccaaa
3001 tcaaatacaa gttttggttt tagatgccca gtaaatacaa aaaaaatgcc
3051 aaaaaattgt tttacgcaag tatatgaaaa agggtatcta aatgacgcca
3101 ataaaattaa tactaaaaat gttattaact attcatttga aaatccagaa
3151 tatgcgctag ctggttytaa ttatacatta acaaaatcgt atcaatttga
3201 atgtcattgt gtagataaag aaacagaaca aattgtaaaa acggttttag
3251 tcaaatatgt aaatgaagat gaaatatatg attataatga ttttccaatg
3301 gtgaatcaca aacctattat tgcacatcca aataaaacac atcaagcttg
3351 catgcctgca gcccagctta attcttttcg agctctttat gcttaagttt
3401 acaatttaat attcatactt taagtatttt ttgtagtatc ctagatattg
3451 tgctttaaat gctcacccct caaagcacca gtaatatttt catccactga
3501 aataccatta aattttcaaa aaaatactat gcatataatg ttatacatat
3551 aaacataaaa cgccatgtaa atcaaaaaat atataaaaat atgtataaaa
3601 ataaatatgc actaaatata agctaattat gcataaaaat taaagtgccc
3651 tttattaact agtcgtaatt atttatattt ctatgttata aaaaaatcct
3701 catataataa tataattaat atatgtaatg ttttttttat tttataattt
3751 taatataaaa taatatgtaa attaattcaa aaaataaata taattgttgt
3801 gaaacaaaaa acgtaatttt ttcatttgcc ttcaaaattt aaatttattt
3851 taatatttcc taaaatatat atactttgtg tataaatata taaaaatata
3901 tatttgctta taaataaata aaaaatttta taaaacatag ggggatccat
3951 gagtaaagga gaagaacttt tcactggagt tgtcccaatt cttgttgaat
4001 tagatggtga tgttaatggg cacaaatttt ctgtcagtgg agagggtgaa
4051 ggtgatgcaa catacggaaa acttaccctt aaatttattt gcactactgg
4101 aaaactacct gttccatggc caacacttgt cactactttc ggttatggtg
4151 ttcaatgctt tgcgagatac ccagatcata tgaaacagca tgactttttc
4201 aagagtgcca tgcccgaagg ttatgtacag gaaagaacta tatttttcaa
4251 agatgacggg aactacaaga cacgtgctga agtcaagttt gaaggtgata
4301 cccttgttaa tagaatcgag ttaaaaggta ttgattttaa agaagatgga
4351 aacattcttg gacacaaatt ggaatacaac tataactcac acaatgtata
4401 catcatggca gacaaacaaa agaatggaat caaagttaac ttcaaaatta
4451 gacacaacat tgaagatgga agcgttcaac tagcagacca ttatcaacaa
4501 aatactccaa ttggcgatgg ccctgtcctt ttaccagaca accattacct
4551 gtccacacaa tctgcccttt cgaaagatcc caacgaaaag agagaccaca
4601 tggtccttct tgagtttgta acagctgctg ggattacaca tggcatggat
4651 gaactataca aataaatgga tcccgttttt cttacttata tatttatacc
4701 aattgattgt atttataact gtaaaaatgt gtatgttgtg tgcatatttt
4751 tttttgtgca tgcacatgca tgtaaatagc taaaattatg aacattttat
4801 tttttgttca gaaaaaaaaa actttacaca cataaaatgg ctagtatgaa
4851 tagccatatt ttatataaat taaatcctat gaatttatga ccatattaaa
4901 aatttagata tttatggaac ataatatgtt tgaaacaata agacaaaatt
4951 attattatta ttattatttt tactgttata attatgttgt ctcttcaatg
5001 attcataaat agttggactt gatttttaaa atgtttataa tatgattagc
5051 atagttaaat aaaaaaagtt gaaaaattaa aaaaaaacat ataaacacaa
5101 atgatgtttt ttccttcaat ttcgggtacc gagctcgaat tctcttgagc
5151 ccgttaatga aatagataca attcattcat gttatataca tctagaacat
5201 aatctgaata tggttcaagt taaatgtcca aaaattataa aaagtgatga
5251 tatttttgat ggtaatacca taatagacac caaggtaaca tcacgaagta
5301 gtcaacaaaa taatttttat ttagaaaata cagatgttga accagaagaa
5351 atagagaaat ataaaaatat agaatacata ccagaaaacg atgaagtaat
5401 gcatctagac aaaaaagaaa agctagatga tatattacca ggtgttatca
5451 tattagataa aaataaaatg ttcaaagaaa aaggacattt cacttttgtt
5501 actccattaa ttgtagaaaa ggtattaata ttaaaaatat attgtgataa
5551 tactaaaaca ataattaata atatgaaagg gaaaaaaggt attacagtaa
5601 taaggatttc tcaaaataca acaaaaaata aattttatgg atgtgacttt
5651 tcaggtaatt ctaaaaaaac attttactat tccaatgttt atgatttaga
5701 aaaaaaaaat gagttttgtg aaatagaatt aaaagaaaat atagtagtta
5751 gcttaaattg tccaactggt aaaattaatc caaaaaattg ttttagaaat
5801 gtatatataa aaagtaatat gaatgaacaa acaaccgaaa atatagaaaa
5851 tatatttaac gaaataaaag ttatagatgc agattatttt ataaataatt
5901 catcaacctt tttgatgatt tccaaaatta caaaaaaaga gtttgatttt
5951 tattgtacat gtgaagatta taaaaccaaa aatataggaa caatatatat
6001 taaaaattat gaatatctag attcaaaacc taaatataaa aataaacaaa
6051 tttcctatat agatgtagtt ccatacccgc ggggaaaggg cg"
Restriction sites to linearize plasmid KspI (SacII)
Selectable marker used to select the mutant parasitegfp (FACS)
Promoter of the selectable markereef1a
Selection (positive) procedureFACS (flowsorting)
Selection (negative) procedureNo
Additional remarks genetic modificationThe GFP gene (1 copy) has been inserted into the 230p locus (PB000214.00.0) by double cross-over integration.
Additional remarks selection procedureThis reporter mutant expressing GFP does not contain a drug-selectable marker. This mutant has been selected by FACS sorting after transfection based on GFP fluorescence.
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_0306000
Gene product6-cysteine protein
Gene product: Alternative name230p
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 15'-cccaagcttccgcgggtatatggtaaagaacctactaacac
Additional information primer 1primer L1345: 0.7kb 5'region of PB000214.00.0 (230p gene)
Sequence Primer 25'-cccaagcttgatgtgttttatttggatgtgc
Additional information primer 2primer L1346: 0.7kb 5'region of PB000214.00.0 (230p gene)
Sequence Primer 35'-ccggaattctcttgagcccgttaatg
Additional information primer 3primer L1347: 1kb 3'region of PB000214.00.0 (230p gene)
Sequence Primer 45'-tccccgcgggtatggaactacatctatatagg
Additional information primer 4primer L1348: 1kb 3'region of PB000214.00.0 (230p gene)