Summary

RMgm-606
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_1212600; Gene model (P.falciparum): PF3D7_1014200; Gene product: male gamete fusion factor HAP2, putative (HAP2; HAPLESS2; GCS1, generative cell specific 1)
Details mutation: The C-terminal region (downstream from the TM domain; amino acids 712-728) of hap2/gcs1 deleted
Phenotype Fertilization and ookinete;
Last modified: 31 January 2011, 09:17
  *RMgm-606
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21209845
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherM. Hirai
Name Group/DepartmentDepartment of Parasitology, Graduate School of Medicine
Name InstituteGunma University
CityGunma
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-606
Principal name-C KI
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal ookinete production
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of HAP2/GCS1 lacking the entire C-terminal region downstream from the trans-membrane (TM) domain (amino acids 712-728).

Protein (function)
In Arabidopsis the male-specific sterility protein HAP2 has been identified by a genetic screen (HAP mutants: containing haploid-disrupting (hapless) mutations; Johnson M.A. et al., 2004, Genetics 168, 971-82) . A HAP2 family member called GCS1 (for generative cell-specific) was subsequently identified in a screen for lily genes whose transcripts were up-regulated in sperm (generative cells) . HAP2 is conserved and members were found in rice, Chlamydomonas, a red alga, a slime mold, Plasmodium falciparum, and Leishmania major.
Phenotype analyses of Plasmodium mutants lacking expression of HAP2/GCS1  (RMgm-155, RMgm-156) indicate a role of HAP/GCS1 in fertilisation. Female gametes are fertile, whereas male gametes are sterile. Male gametes are able to attach to female gametes and form tight prefusion membrane attachments but the membranes of the gametes do not merge or fuse. As a result no zygotes/ookinetes are formed.

Phenotype
Ookinete production is comparable to ookinete production of wild type parasites, indicating that the the C-terminal region downstream from the trans-membrane (TM) domain is not essential for the function of HAP2/GCS1. Mutants lacking expression of HAP2/GCS1(RMgm-155, RMgm-156) show a defect in fertilisation and ookinete production.

Additional information
The phenotype has not been analyzed in detail. No information is provided on production of gametocytes and gametes, the process of fertilization or gamete fusion. The effect of the mutation has only been analyzed by quantification of ookinete production.

A mutant has been generated in which the endogenous hap2/gsc1 gene was replaced by a wild type copy of hap2/gsc1 (mutant PbGCS1 Full KI). This mutant was used as a control to analyse the effect of the genetic modification of the locus on male fertility. The DNA construct used to generate the PbGCS1 Full KI line served as PCR template for preparing the DNA constructs used to generate the -HG (RMgm-605), -C and -TM/C (RMgm-607) mutant lines.

Other mutants
RMgm-155: An independent mutant lacking expression of HAP2/GCS1.
RMgm-156: A mutant lacking expression of HAP2/GCS1.
RMgm-157: A mutant expressing a GFP-tagged form of HAP2/GCS1
RMgm-167: A mutant expressing a GFP-tagged form of HAP2/GCS1
RMgm-158: A mutant expressing GFP under the control of the hap2/gcs1 promoter
RMgm-605: A mutant expressing a mutated form of HAP2/GCS1 lacking the HAP2-GCS1 (HG) domain
RMgm-607: A mutant expressing a mutated form of HAP2/GCS1 lacking the TM domain and the entire C-terminal region downstream from the TM


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1212600
Gene Model P. falciparum ortholog PF3D7_1014200
Gene productmale gamete fusion factor HAP2, putative
Gene product: Alternative nameHAP2; HAPLESS2; GCS1, generative cell specific 1
Details of the genetic modification
Short description of the mutationThe C-terminal region (downstream from the TM domain; amino acids 712-728) of hap2/gcs1 deleted
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, XbaI
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationFor production of the –C construct, inverse PCR was employed to remove the entire C-terminal region (downstream from TM) from the PbGCS1 Full construct with the -CInvF/–CInvR primer set and the PbGCS1 Full construct as a template. The PCR product was treated with DpnI to digest the PbGCS1 Full template plasmid, and the 5’ end was phosphorylated and then self-ligated. The resultant construct was sequenced and cut. The endogenous hap2/gcs1 gene is replaced with the construct.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AGTAGATATAAAAAGGAAAAAGAAATTTAAAAAGAATGGTAGAAG
Additional information primer 1-CInvR
Sequence Primer 2TAAAATTACATGGAATAGTATTTGCAAATTTGTG
Additional information primer 2-CInvF
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6