RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-604

Malaria parasite	P. berghei
Genotype
Mutated	Gene model (rodent): PBANKA_0302500; Gene model (P.falciparum): PF3D7_0204700; Gene product: hexose transporter (hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1) Details mutation: The endogenous pbht1 gene is replaced with the P. falciparum ortholog, pfht1 (PFB0210c)
Phenotype	Asexual bloodstage;

Last modified: 24 January 2011, 15:08

*RMgm-604

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene mutation
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 21169382
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	P. berghei ANKA cl15cy1
Other information parent line	A reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255). DNA constructs were transfected into P. berghei wild type or a P. berghei-GFP line.
top of page
The mutant parasite was generated by
Name PI/Researcher	M. Blume; N. Gupta
Name Group/Department	Department of Molecular Parasitology
Name Institute	Humboldt University
City	Berlin
Country	Germany
top of page
Name of the mutant parasite
RMgm number	RMgm-604
Principal name	Δpbht1-PfHT1
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type. Mutant blood stages have been used to test the sensitivity PfHT1 in vivo to an inhibitor of HT1, the glucose analog C3361.
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Not different from wild type
Oocyst	Not different from wild type
Sporozoite	Not different from wild type
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation In the mutant the endogenous hexose transporter 1 gene (pbht1) is replaced with the P. falciparum ortholog, pfht1 (PFB0210c) Protein (function) PbHT1 and it ortholog PfHT1 are facilitative hexose transporters in the Major Facilitator Superfamily of integral membrane proteins that mediates the uptake of glucose and fructose by the parasite. HT1 of P. falciparum is known to transport glucose and fructose and is essential for blood stage parasites, in vitro (see also mutants RMgm-390, RMgm-391 and 'Additional Information' below). Phenotype In the paper unsuccessful attempt to disrupt pbht1 are reported (see also RMgm-390). These unsuccessful attempts indicate an essential role of PbHT1 in the asexual blood stages. The replacement of the Pbht1 gene with the P. falciparum ortholog Pfht1 indicates that the protein PFHT1 can complement the P. berghei protein PbHT1. Mutant blood stages have been used to test the sensitivity PfHT1 in vivo to an inhibitor of HT1, the glucose analog C3361. Additional information In the paper it is shown that PbHT1 can transport glucose (Km~87 µM), mannose (Ki~93 µM), fructose (Ki~0.54 mM), and galactose (Ki~5 mM). In the paper a mutant RMgm-603 is described in which the endogenous hexose transporter 1 gene (pbht1) is replaced with a HA-tagged copy of pbht1 Other mutants RMgm-390: unsuccessful attempts to disrupt pbht1 RMgm-391: a mutant expressing a GFP-tagged form of PbHT1 RMgm-603: A mutant in which the endogenous hexose transporter 1 gene (pbht1) is replaced with a HA-tagged copy of pbht1.

Mutated: Mutant parasite with a mutated gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_0302500

Gene Model P. falciparum ortholog

PF3D7_0204700

Gene product

hexose transporter

Gene product: Alternative name

hexose transporter 1, HT1; PfHT1, PfHT, PbHT, PbHT1

top of page

Details of the genetic modification

Short description of the mutation

The endogenous pbht1 gene is replaced with the P. falciparum ortholog, pfht1 (PFB0210c)

Inducable system used

Short description of the conditional mutagenesis

Not available

Additional remarks inducable system

Type of plasmid/construct

Plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

KpnI, NotI

Selectable marker used to select the mutant parasite

tgdhfr

Promoter of the selectable marker

pbdhfr

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

The endogenous pbht1 gene is replaced with the P. falciparum ortholog, pfht1. Primers 1-4 show the primers used to amplify the 3'- and 5'-target regions of pbht1. Primer 5-6 are the primers to generate/amplify the P. falciparum ortholog, pfht1 (PFB0210c)

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	CTCATCGCGGCCGCGCAAAACTAAATCGGATTAATGCCGA
Additional information primer 1	PbHT1–5’UTR-F, NotI
Sequence Primer 2	CTCATCGGATCCACGCAATATATTCATTTTTTCGTATTAATACACATATATTTCTTG
Additional information primer 2	PbHT1–5’UTR-R, BamHI
Sequence Primer 3	CTCATCGGGCCCCATACAAGAACACACCGGCAAT
Additional information primer 3	PbHT1–3’UTR-F, ApaI
Sequence Primer 4	CTCATCGGTACCCTTATGTTAAACAATTATCCTTTCCAATTATCACAC
Additional information primer 4	PbHT1–3’UTR-R, KpnI
Sequence Primer 5	CTCATCGGATCCAAAATGACGAAAAGTTCGAAAGATATATGTAGTGAG
Additional information primer 5	PfHT1-F, BamHI
Sequence Primer 6	CTCATCGGATCCTCATACAACCGACTTGGTCATATGC
Additional information primer 6	PfHT1-R, BamHI

top of page