RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-601
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1436600; Gene model (P.falciparum): PF3D7_1221400; Gene product: inner membrane complex protein 1h, putative (Inner membrane complex protein 1h; IMC1h)
Transgene
Transgene not Plasmodium: EGFP
Promoter: Gene model: PBANKA_1436600; Gene model (P.falciparum): PF3D7_1221400; Gene product: inner membrane complex protein 1h, putative (Inner membrane complex protein 1h; IMC1h)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Replacement locus: Gene model: PBANKA_1436600; Gene product: inner membrane complex protein 1h (IMC1h)
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 3 August 2012, 22:02
  *RMgm-601
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21098480
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA.Z. Tremp; J.T. Dessens
Name Group/DepartmentDepartment of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene & Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-601
Principal nameIMC1h-KO
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNormal numbers of ookinetes are produced. Mature ookinetes showed abnormal morphology. Ookinetes were wider, shorter and possessed a bulging area typically in the central part of the cell. Infectivity of ookinetes was reduced (ookinetes produced ~30-fold less oocysts in A. stephensi).
OocystInfectivity of ookinetes was reduced (ookinetes produced ~30-fold less oocysts in A. stephensi). Oocysts appeared to develop normally, forming large numbers of sporozoites. However, all sporozoites were of abnormal shape, typically possessing a bulging area near the middle of the sporozoite. No sporozoites were detected in salivary glands.
SporozoiteOocysts appeared to develop normally, forming large numbers of sporozoites. However, all sporozoites were of abnormal shape, typically possessing a bulging area near the middle of the sporozoite. No sporozoites were detected in salivary glands.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of Inner membrane complex protein 1h (IMC1h)

Protein (function)
The imcb1h gene belongs to small 'family' of conserved genes that express putative membrane skeleton proteins which contain domains that share sequence homology to domains of articulins, proteins of membrane skeleton of free-living protists and show homology to the inner membrane complex protein 1 (TgIMC1) of the subpellicular network of Toxoplasma gondii tachyzoites (Khater, E.I., et al. 2004, J. Cell. Biol. 167, 425-32) . In Plasmodium eight conserved IMC1 protein family members have been identified, named IMC1a-IMC1h. Two of these, IMC1a and IMC1b, were shown to be differentially expressed in sporozoites and ookinetes, respectively, and to form part of their pellicle structures in P. berghei. IMC1a and IMC1b are structurally and functionally homologous and involved in parasite morphology, mechanical strength, gliding motility and infectivity, in accordance with their roles as membrane skeleton proteins (see also mutanst RMgm-147 and RMgm-148 lacking expression of IMC1b and IMC1a). IMC1h, is found in the pellicle of both ookinetes and sporozoites (see mutant RMgm-600) and acts in a very similar way to IMC1b and IMC1a (see below)

Phenotype
Phenotype analyses of a mutant expressing GFP-tagged  IMC1h (RMgm-600) shows expression of the protein in ookinetes, sporulating oocysts and sporozoites with evidence for a pellicaular location.
Phenotype analyses of the mutant lacking IMC1h indicates a role of this protein in morphology/shape of ookinetes and sporozoites and in motility of both stages.
Mature ookinetes showed abnormal morphology. Ookinetes were wider, shorter and possessed a bulging area typically in the central part of the cell. This phenotype is the same as that observed in ookinetes lacking expression of IMC1b (RMgm-147) and is consistent with a role of IMC1h as a membrane skeleton protein.
Infectivity of ookinetes was reduced (they produced ~30-fold less oocysts. Oocysts appeared to develop normally, forming large numbers of sporozoites. However, all sporozoites were of abnormal shape, typically possessing a bulging area near the middle of the sporozoite reminiscent of sporozoites lacking expression of IMC1a (RMgm-148). No sporozoites were detected in salivary glands.
Analysis of a mutant lacking expression of both IMC1h and IMC1b (RMgm-602) provides evidence that for a direct involvement of IMC1 proteins in gliding motility uncoupled from cell shape.

Additional information
An orthologue of IMC1h was identified in T. gondii, named TgIMC3 (AAT49041). TgIMC3  is a pellicle-associated protein of tachyzoites. The PIMC1h and TgIMC3 proteins share two conserved domains: a central articulin-like domain related to the IMCp domain superfamily (Pfam12314) that defines the alveolins, and a carboxy-terminal domain that is unique to PIMC1h and TgIMC3. None of the Plasmodium MC1h proteins identified possess cysteine motifs at amino- and carboxy-termini described in  TgIMC1 and PbIMC1a.

Other mutants
RMgm-147: A mutant lacking expression of IMC1b
RMgm-148: A mutant lacking expression of IMC1a
RMgm-163: A mutant expressing a GFP-tagged form of IMC1b
RMgm-600: A mutant expressing a GFP-tagged form of IMC1h
RMgm-602: A mutant lacking expression of both IMC1h and IMC1b


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1436600
Gene Model P. falciparum ortholog PF3D7_1221400
Gene productinner membrane complex protein 1h, putative
Gene product: Alternative nameInner membrane complex protein 1h; IMC1h
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, SacII
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption All but the first 25 amino acids of the imc1h ORF have been removed.
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPlasmid pLP-IMC1h/EFGP, used to generate the IMC1h/EGFP mutant described in RMgm-600, served as a template for PCR using primers IMC1hKO-F (ATTTAGCTATGAGTAAAGGAGAAGAACTTTTCAC) and IMC1hKO-R (TTACTCATAGCTAAATTGTCATAATTCAGTTCATC). The amplified plasmid DNA was recircularised via In-Fusion cloning, resulting in the transfection construct pLP-ΔIMC1h/EGFP, in which all but the first 25 amino acids of the imc1h ORF have been removed. This plasmid was used to introduce the hdhfr and a GFP reporter gene under the control of the native imc1h promotor into the imc1h locus.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ATTTAGCTATGAGTAAAGGAGAAGAACT
Additional information primer 1IMC1hKO-F
Sequence Primer 2TTACTCATAGCTAAATTGTCATAATTCAGTTCATC
Additional information primer 2IMC1hKO-F
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameEGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, SacII
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationIn this parasite line gfp acts as a reporter gene under control of the native imc1h promoter.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1436600
Gene Model P. falciparum ortholog PF3D7_1221400
Gene productinner membrane complex protein 1h, putative
Gene product: Alternative nameInner membrane complex protein 1h; IMC1h
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionReplacement locus
Gene Model of Parasite PBANKA_1436600
Gene productinner membrane complex protein 1h
Gene product: Alternative nameIMC1h
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4