Summary

RMgm-600
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1436600; Gene model (P.falciparum): PF3D7_1221400; Gene product: inner membrane complex protein 1h, putative (Inner membrane complex protein 1h; IMC1h)
Name tag: EGFP
Phenotype Fertilization and ookinete; Oocyst; Sporozoite;
Last modified: 15 January 2011, 20:24
  *RMgm-600
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21098480
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherA.Z. Tremp; J.T. Dessens
Name Group/DepartmentDepartment of Pathogen Molecular Biology, Faculty of Infectious and Tropical Diseases
Name InstituteLondon School of Hygiene & Tropical Medicine
CityLondon
CountryUK
Name of the mutant parasite
RMgm numberRMgm-600
Principal nameIMC1h/GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookinetestrong GFP-fluorescence in ookinetes
Oocyststrong GFP-fluorescence in sporulating oocysts
Sporozoitestrong GFP-fluorescence in sporozoites
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a GFP-tagged form of Inner membrane complex protein 1h (IMC1h) under the control of its own promoter

Protein (function)
The imcb1h gene belongs to small 'family' of conserved genes that express putative membrane skeleton proteins which contain domains that share sequence homology to domains of articulins, proteins of membrane skeleton of free-living protists and show homology to the inner membrane complex protein 1 (TgIMC1) of the subpellicular network of Toxoplasma gondii tachyzoites (Khater, E.I., et al. 2004, J. Cell. Biol. 167, 425-32) . In Plasmodium eight conserved IMC1 protein family members have been identified, named IMC1a-IMC1h. Two of these, IMC1a and IMC1b, were shown to be differentially expressed in sporozoites and ookinetes, respectively, and to form part of their pellicle structures in P. berghei. IMC1a and IMC1b are structurally and functionally homologous and involved in parasite morphology, mechanical strength, gliding motility and infectivity, in accordance with their roles as membrane skeleton proteins (see also mutanst RMgm-147 and RMgm-148 lacking expression of IMC1b and IMC1a). IMC1h, is found in the pellicle of both ookinetes and sporozoites (see below) and plays a role in in morphology/shape of ookinetes and sporozoites and in motility of both stages (see mutant RMgm-601 which lacks expression of IMC1h  and mutant RMgm-602 which lacks expression of both IMC1h and IMC1b .

Phenotype
Strong GFP-fluorescence in ookinetes, sporulating oocysts and sporozoites, but no fluorescence in blood stage parasites. In ookinetes as well as in sporozoites the majority of the GFP-fluorescence was found at the periphery of the cells. These observations are supportive of a pellicular localisation of IMC1h in ookinetes and sporozoites, consistent with its predicted function as a membrane skeleton protein.
See also mutant RMgm-601 which lacks expression of IMC1h  and mutant RMgm-602 which lacks expression of both IMC1h and IMC1b .

Additional information

Other mutants
RMgm-147: A mutant lacking expression of IMC1b
RMgm-148: A mutant lacking expression of IMC1a
RMgm-163: A mutant expressing a GFP-tagged form of IMC1b
RMgm-601: A mutant lacking expression of IMC1h
RMgm-602: A mutant lacking expression of both IMC1h and IMC1b


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1436600
Gene Model P. falciparum ortholog PF3D7_1221400
Gene productinner membrane complex protein 1h, putative
Gene product: Alternative nameInner membrane complex protein 1h; IMC1h
Details of the genetic modification
Name of the tagEGFP
Details of taggingC-terminal
Additional remarks: tagging
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid KpnI, SacII
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe coding sequence of imc1h plus 0.57 kb of the 5′UTR were PCR amplified with primers pDNR-IMC1h-F (ACGAAGTTATCAGTCGACGGTACCTAATGGAAAAATTATCTCGTACG) and pDNR-IMC1h-R (ATGAGGGCCCCTAAGCTTATGTTTTTCTGGATAGCTTTAACATC) and introduced into SalI/HindIII-digested pDNR-EGFP via In-Fusion cloning to give plasmid pDNR-IMC1h/EGFP. A 0.71-kb sequence corresponding to the 3′UTR of imc1h was PCR amplified with primers pLP-IMC1h-F (AGAGCGGCCGCCCCCTAATCTTATCTTTACAAATATTAAAACAATG) and pLP-IMC1h-R (AGCTGGAGCTCCACCGCGGTTGAATAAGGGGCATGAATG) and introduced into SacII digested pLP-hDHFR via In-Fusion cloning to give plasmid pLP-DHFR/IMC1h. The IMC1hspecific sequence from pDNR-IMC1h/EGFP was introduced into pLP-DHFR/IMC1h via CreloxP site-specific recombination to give the final transfection construct pLP-IMC1h/EGFP, used to introduce a GFPtagged version of imc1h into its locus
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1ACGAAGTTATCAGTCGACGGTACCTAATGGAAAAATTATCTCGTACG
Additional information primer 1pDNR-IMC1h-F
Sequence Primer 2ATGAGGGCCCCTAAGCTTATGTTTTTCTGGATAGCTTTAACATC
Additional information primer 2pDNR-IMC1h-R
Sequence Primer 3AGAGCGGCCGCCCCCTAATCTTATCTTTACAAATATTAAAACAATG
Additional information primer 3pLP-IMC1h-F
Sequence Primer 4AGCTGGAGCTCCACCGCGGTTGAATAAGGGGCATGAATG
Additional information primer 4pLP-IMC1h-R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6