Summary

RMgm-595
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: firefly luciferase
Promoter: Gene model: PBANKA_0402000; Gene model (P.falciparum): PF3D7_0303400; Gene product: palmitoyltransferase DHHC1
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: Not available; Gene product: Not available (small subunit ribosomal rna gene (c-type and/or d-type unit))
Transgene
Transgene not Plasmodium: Renilla luciferase
Promoter: Gene model: PBANKA_1133300; Gene model (P.falciparum): PF3D7_1357100; Gene product: elongation factor 1-alpha (eef1a)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: Not available; Gene product: Not available (small subunit ribosomal rna gene (c-type and/or d-type unit))
Phenotype Asexual bloodstage; Oocyst; Sporozoite; Liver stage;
Last modified: 24 December 2010, 18:56
  *RMgm-595
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene, Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21048918
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherS. Helm; V.T. Heussler
Name Group/DepartmentMalaria Laboratory 1
Name InstituteBernhard Nocht Institute for Tropical Medicine
CityHamburg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-595
Principal namePbFL869RLef1a
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationNo
Phenotype
Asexual blood stageA high firefly luciferase (FL) expression in sporozoites but nearly no FL activity in the blood and oocyst stage as well as in vitro in early liver stages
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystA high firefly luciferase expression in sporozoites but nearly no FL activity in the blood and oocyst stage as well as in vitro in early liver stages
SporozoiteA high firefly luciferase expression in sporozoites but nearly no FL activity in the blood and oocyst stage as well as in vitro in early liver stages
Liver stageA high firefly luciferase expression in sporozoites but nearly no FL activity in the blood and oocyst stage as well as in vitro in early liver stages. Increasing luciferase activity in late liver stages (>48h)
Additional remarks phenotype

Mutant/mutation
A mutant expressing firefly luciferase (FL) under control of the promoter of PBANKA_040200 (palmitoyl transferase) and Renilla luciferase (RL) under control of the constitutive eef1a promoter

Protein (function)
No data is presented on the function of PBANKA_040200 (palmitoyl transferase).

Phenotype
A high firefly luciferase expression in sporozoites but nearly no FL activity in the blood and oocyst stage as well as in vitro in early liver stages. Increasing luciferase activity in late liver stages (>48h).

Additional information
In this study, this mutant is used as a control to measure promoter activity in liver stages using tow different luciferases (firefly, Renilla) introduced on a single plasmid (see RMgm-594). PBANKA_040200 was identified as being expressed at a low level in the liver relative to other stages. The upstream region of this gene was cloned in front of the FL resulting in the plasmid pFL869RLef1a (see also RMgm-594).
The plasmid used, allows integration into the P. berghei d/c ssu rrna locus, but is also able to persist in the parasite population as an episome. As both luciferases are encoded on the plasmid and therefore the genes are always present in equal numbers, it was not necessary to analyze genetically whether the parasite populations contained integrated or episomal gene copies or (as is most likely) a mixture of both.

Other mutants
RMgm-593: A mutant expressing gfp under control of the PBANKA_100300 promoter
RMgm-594: A mutant expressing firefly luciferase under control of the PBANKA_100300 promoter and Renilla luciferase under control of the constitutive eef1a promoter
 


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene namefirefly luciferase
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI, SacII
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPBANKA_040200 (PB000869.01.0) was identified as being expressed at a low level in the liver relative to other stages. The upstream region of this gene was cloned in front of the FL resulting in the plasmid pFL869RLef1a (see also RMgm-594).
The plasmid used allows integration into the P. berghei d/c ssu rRNA locus, but is also able to persist in the parasite population as an episome. As both luciferases are encoded on the plasmid and therefore the genes are always present in equal numbers, it was not necessary to analyze genetically whether the parasite populations contained integrated or episomal gene copies or (as is most likely) a mixture of both.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_0402000
Gene Model P. falciparum ortholog PF3D7_0303400
Gene productpalmitoyltransferase DHHC1
Gene product: Alternative name
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1GGCCGCGGCCGCGTCTAAAGCATACAATAACTCTTAC
Additional information primer 1Promoter region Forward (NotI)
Sequence Primer 2CTAGCCTAGGTTTGTATATTTCTGAGATTCCAAAAAAA
Additional information primer 2Promoter region Reverse (AvrII)
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative namesmall subunit ribosomal rna gene (c-type and/or d-type unit)
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4

  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameRenilla luciferase
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI, SacII
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPBANKA_040200 (PB000869.01.0) was identified as being expressed at a low level in the liver relative to other stages. The upstream region of this gene was cloned in front of the FL resulting in the plasmid pFL869RLef1a (see also RMgm-594).
The plasmid used allows integration into the P. berghei d/c ssu rRNA locus, but is also able to persist in the parasite population as an episome. As both luciferases are encoded on the plasmid and therefore the genes are always present in equal numbers, it was not necessary to analyze genetically whether the parasite populations contained integrated or episomal gene copies or (as is most likely) a mixture of both.
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1133300
Gene Model P. falciparum ortholog PF3D7_1357100
Gene productelongation factor 1-alpha
Gene product: Alternative nameeef1a
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative namesmall subunit ribosomal rna gene (c-type and/or d-type unit)
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4