RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-593
Malaria parasiteP. berghei
Genotype
Transgene
Transgene not Plasmodium: GFP
Promoter: Gene model: PBANKA_1003000; Gene model (P.falciparum): PF3D7_0405300; Gene product: liver specific protein 2, putative | sequestrin | 6-cysteine protein (LISP2)
3'UTR: Gene model: PBANKA_0719300; Gene product: bifunctional dihydrofolate reductase-thymidylate synthase, putative (dhfr/ts)
Insertion locus: Gene model: Not available; Gene product: Not available (small subunit ribosomal rna gene (c-type and/or d-type unit))
Phenotype Liver stage;
Last modified: 6 November 2013, 18:46
  *RMgm-593
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Introduction of a transgene
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21048918
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherS. Helm; V.T. Heussler
Name Group/DepartmentMalaria Laboratory 1
Name InstituteBernhard Nocht Institute for Tropical Medicine
CityHamburg
CountryGermany
Name of the mutant parasite
RMgm numberRMgm-593
Principal namePbGFP103464
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNot different from wild type
Liver stageDuring parasite development in hepatocytes, GFP expression was strongly upregulated at 48 hpi and continued until merosome formation, the end-point of liver stage development.
Additional remarks phenotype

Mutant/mutation
The mutant expresses GFP under the control of the liver stage specific gene PBANKA_100300 (sequestrin)

Protein (function)
No data is presented on the function of sequestrin. This gene has been identified in a DNA microarray study as expressed solely during the liver stage. Expression experiments presented in this paper confirm the liver stage expression.

Phenotype
During parasite development in hepatocytes, GFP expression was strongly upregulated at 48 hpi and continued until merosome formation, the end-point of liver stage development.

Additional information
In order to determine possible transcription factor binding sites in the 989 bp promoter region, the transcription start site (TSS) for PBANKA_100300 was identified. 5'RACE revealed a TSS at position -318 restricting the DNA region interacting with transcription factors to between position -989 to -318. In this region, four potential binding sites for ApiAP2 (PBANKA_090960) transcription factors were identified. To analyse the effect of the binding sites, 3 additional mutants were generated with specific promoter deletions (PbFL103464(-775)RLef1a (-775/+1) and PbFL103464(-318)RLef1a (-318/+1)) or a promoter mutation (PbFL103464(*825)RLef1amut-825/-818). These mutants are not included in RMgmDB.

Other mutants
RMgm-594: A mutant expressing firefly luciferase under control of the PBANKA_100300 promoter and Renilla luciferase under control of the constitutive eef1a promoter
RMgm-595: A mutant expressing firefly luciferase under control of the PBANKA_040200 promoter and Renilla luciferase under control of the constitutive eef1a promoter


  Transgene: Mutant parasite expressing a transgene
Type and details of transgene
Is the transgene Plasmodium derived Transgene: not Plasmodium
Transgene nameGFP
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/constructPlasmid single cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI, SacII
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationBetween the start codon of the PBANKA_100300 gene and the next gene upstream, a region of 989bp is present. This region, baring the promoter driving expression of PBANKA_100300, was used to replace the pbeef1aa promoter in plasmid pL0017 (MR4: MRA-786) to create plasmid pGFP103464.

The gfp gene and the 989bp PBANKA_100300 promoter region have been integrated into the genome by single cross-over integration. Therefore the possibility exists of reversion to the wild-type genotype by removal of the integrated DNA construct. In this mutant one or multiple copies of the gfp gene are integrated into the small subunit ribosomal rna gene (c-type or d-type unit). No gene model is yet available for this integration locus!
Additional remarks selection procedure
Other details transgene
Promoter
Gene Model of Parasite PBANKA_1003000
Gene Model P. falciparum ortholog PF3D7_0405300
Gene productliver specific protein 2, putative | sequestrin | 6-cysteine protein
Gene product: Alternative nameLISP2
Primer information details of the primers used for amplification of the promoter sequence  Click to view information
Primer information details of the primers used for amplification of the promoter sequence  Click to hide information
Sequence Primer 1CGGATATCGTTGCATTATCGTCAAAAGTG
Additional information primer 1Promoter region Forward (EcoRV)
Sequence Primer 2CGGGATCCTTTTTATGTGTAAAAAAGTAAAATGATT
Additional information primer 2Promoter region Reverse (BamHI)
3'-UTR
Gene Model of Parasite PBANKA_0719300
Gene productbifunctional dihydrofolate reductase-thymidylate synthase, putative
Gene product: Alternative namedhfr/ts
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to view information
Primer information details of the primers used for amplification the 3'-UTR sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Insertion/Replacement locus
Replacement / InsertionInsertion locus
Gene Model of Parasite Not available
Gene productNot available
Gene product: Alternative namesmall subunit ribosomal rna gene (c-type and/or d-type unit)
Primer information details of the primers used for amplification of the target sequences  Click to view information
Primer information details of the primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1
Additional information primer 1
Sequence Primer 2
Additional information primer 2
Sequence Primer 3
Additional information primer 3
Sequence Primer 4
Additional information primer 4