Summary

RMgm-588
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0917400; Gene model (P.falciparum): PF3D7_1130800; Gene product: armadillo repeat protein PF16, putative (PF16)
Phenotype Gametocyte/Gamete; Fertilization and ookinete; Oocyst; Sporozoite; Liver stage;
Last modified: 21 October 2010, 11:38
  *RMgm-588
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20886115
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA 2.34
Other information parent lineP. berghei ANKA 2.34 is a cloned, gametocyte producer line of the ANKA strain (PubMed: PMID: 15137943).
The mutant parasite was generated by
Name PI/ResearcherU. Straschil; R. Tewari
Name Group/DepartmentInstitute of Genetics, School of Biology
Name InstituteUniversity of Nottingham
CityNottingham
CountryUK
Name of the mutant parasite
RMgm numberRMgm-588
Principal namepf16.3; pf16.4
Alternative namepbpf16 knockout
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNormal production of male and female gametocytes. Normal rates of male gamete formation as measured by the number of exflagellating male gametocytes. Male gametes showed reduced motility and fertility, with 50% of male gametes being immotile (see also 'Additional information phenotype').
Fertilization and ookineteNormal production of male and female gametocytes. Normal rates of male gamete formation as measured by the number of exflagellating male gametocytes. Male gametes showed reduced motility and fertility, with 50% of male gametes being immotile. The fertilisation rate as measured by the in vitro formation of ookinete was 20% compared to 70-80% in wild type gametes.
OocystThe fertilisation rate of gametes as measured by the in vitro formation of ookinete was 20% compared to 70-80% in wild type gametes. Ookinetes formed in vivo during a mosquito feed are able to give rise to a significant number of oocysts and generate normal sporozoites that are infectious to mice.
SporozoiteThe fertilisation rate of gametes as measured by the in vitro formation of ookinete was 20% compared to 70-80% in wild type gametes. Ookinetes formed in vivo during a mosquito feed are able to give rise to a significant number of oocysts and generate normal sporozoites that are infectious to mice.
Liver stageThe fertilisation rate of gametes as measured by the in vitro formation of ookinete was 20% compared to 70-80% in wild type gametes. Ookinetes formed in vivo during a mosquito feed are able to give rise to a significant number of oocysts and generate normal sporozoites that are infectious to mice.
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of PF16 (PBANKA_091740; PF11_0318)
Note that the PF16 gene is distinct from Pfs16, another gametocyte specific gene identified in P. falciparum (PFD0310w).

Protein (function)
All eukaryotic flagella contain an axoneme, a structure consisting of a central apparatus (a pair of microtubules named C1 and C2) encircled by nine doublet microtubules. PF16 is an important Armadillo (ARM)-repeat protein of the central apparatus of eukaryotic flagella. ARM-repeats consist of a ~42-amino acid structurally conserved repeating motif named after the Drosophila segment polarity gene Armadillo (mammalian homologue, b-catenin). Proteins containing ARM-repeats have diverse roles in eukaryotes, including cell signalling, cytoskeletal organisation and regulation of gene expression. Inactivation of the Chlamydomonas PF16 gene led to loss of the central pair of microtubules and abnormal flagellar function, showing that PF16 is required for flagellar motility and stability of the central apparatus C1 microtubule. Disruption of SPAG6, the mouse PF16 orthologue, results in male infertility, due to loss of sperm motility.RNAi of PF16 in the flagellated protozoan Trypanosoma brucei demonstrates a conserved role in flagellum-dependent motility.

Phenotype
The phenotype analyses indicate that PF16 plays a crucial role maintaining the correct microtubule structure in the central apparatus of the axoneme of the male gamete (see also 'Additional information'). Mutant male gametes show abnormal flagellar movement and reduced fertility, but lack of PF16 expression does not lead to complete sterility.

Additional information
PF16 is expressed in male gametocytes and male gametes as shown by analysis of a mutant parasite that expresses a GFP-tagged form of PF16 (see mutant RMgm-589).

Male gametes showed reduced motility and fertility, with 50% of male gametes being immotile. The flagellar beat pattern of mutant male gametes differed from wild type; it was characterised by a significantly lower beat frequency and beat amplitude together with a significantly reduced speed.

The formation of male gametes was analysed by electron microscopy. The development of the axonemes of Plasmodium male gametes is unusual, as they do not arise from a classical centriole/basal body with nine concentric triple microtubules. Instead, there is an electron dense structure in which nine single microtubules have been identified. This can result a slightly uncoordinated assembly process where the majority of axonemes consist of a central pair of microtubules (central apparatus) encircled by 9 doublets of microtubules with associated dynein arms. However, some axonemes lack the central pair (9+0) or the peripheral doublets forming an ‘S’ shape rather than a circle. Similar structures were observed in the  mutant, however a significant number of the axonemes have one missing central tubule (9+1). The mature microgamete consists of an elongated, undulating axoneme with a flattened electron-dense nucleus in the central region, which follows the contours of the axoneme, all enclosed by a unit membrane. In  wild type parasites, the vast majority (96%) displayed the typical 9+2 arrangement with only rare examples of 9+0 (2%) or 9+1 (2%). However, the mutant showed a marked increase in the number of  microgametes with atypical axonemes. Only 12% had the normal 9+2 structure while 21% had 9+0 and 67% had a 9+1 structure. Therefore, the loss of PbPF16 results in increased numbers of abnormal microgametes with the majority lacking one central microtubule (9+1) and a significant number lacking both central microtubules (9+0).

Other mutants
RMgm-589: a P. berghei mutant expressing a GFP-tagged form of PF16


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0917400
Gene Model P. falciparum ortholog PF3D7_1130800
Gene productarmadillo repeat protein PF16, putative
Gene product: Alternative namePF16
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid ApaI, XbaI
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CCCCGGGCCCGCTCATTATTTCGTAAAAACACAC
Additional information primer 1N0051 (ApaI); 5'Fw
Sequence Primer 2GGGGAAGCTTGCAATATATTAAATGTGGTAATACATC
Additional information primer 2N0052 (HindIII); 5'Rv
Sequence Primer 3CCCCGAATTCCCATCCTATAAAAAATCATTTATTAAG
Additional information primer 3N0053(EcoRI); 3'Fw
Sequence Primer 4GGGGTCTAGACCGATACATGTTATGCATAGTG
Additional information primer 4N0054 (XbaI); 3'Rv
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6