Summary

RMgm-482
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_0205800; Gene model (P.falciparum): PF3D7_0107600; Gene product: serine/threonine protein kinase, putative (IK2; UIS1, up-regulated in infective sporozoites 1)
Phenotype Sporozoite; Liver stage;
Last modified: 21 December 2011, 16:25
  *RMgm-482
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20584882
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent lineA reference wild type clone from the ANKA strain of P. berghei (PubMed: PMID: 17406255).
The mutant parasite was generated by
Name PI/ResearcherM. Zhang; V. Nussenzweig
Name Group/DepartmentMichael Heidelberger Division, Department of Pathology
Name InstituteNew York University School of Medicine
CityNew York
CountryUSA
Name of the mutant parasite
RMgm numberRMgm-482
Principal namePbeIK2(-)
Alternative namePbeIK2(-) ko1; PbeIK2(-) ko2
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNot different from wild type
SporozoiteNormal numbers of salivary gland sporozoites are produced. Sporozoites showed reduced gliding motility and cell traversal capacity in vitro. Invasion of HepG2 cells in vitro was comparable to that of wild type parasites. Infectivity of sporozoites to mice was strongly reduced (as tested by intravenous injection of purified sporozoites or after infection of mice by mosquito bite). Salivary gland sporozoites show premature development into early liver stage forms (see further 'Additional remarks phenotype')
Liver stageSporozoites showed reduced gliding motility and cell traversal capacity in vitro. Invasion of HepG2 cells in vitro was comparable to that of wild type parasites. Infectivity of sporozoites to mice was strongly reduced (as tested by intravenous injection of purified sporozoites or after infection of mice by mosquito bite). Salivary gland sporozoites show premature development into early liver stage forms (see further 'Additional remarks phenotype')
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of eukaryotic initiation factor- 2α (eIF2α) kinase (IK2)

Protein (function)
One control mechanism of protein synthesis in eukaryotic cells involves the phosphorylation of the α-subunit of eukaryotic translation-initiation factor-2 (eIF-2α). During initiation of protein synthesis, a ternary complex of Met-tRNA, GTP, and the eukaryotic initiation factor 2 (eIF2) is delivered to the translation initiation machinery. During this translation process, eIF2-GTP is hydrolyzed to eIF2-GDP and released from the machinery. A guanine nucleotide exchange factor (eIF2B) facilitates the exchange of eIF2-GDP to eIF2-GTP, which is a requisite for a new round of translation. The phosphorylation of eIF2α blocks the recycling of eIF2-GTP and downregulates protein synthesis. The phosphorylation of eIF2α is associated with the appearance of stress granules in the cytoplasm of stressed cells.

Three eIF2α kinases, IK1 (PF14_0423; eukaryotic initiation factor 2alpha kinase 1), IK2 (PfA0380w; PBANKA_020580; serine/threonine protein kinase, putative), and PK4 (PFF1370w; PBANKA_112690; protein kinase PK4), have been identified in Plasmodium (Fenell C et al. 2009. Malar J. 8, 99).

Phenotype
Phenotype analyses indicate that IK2 is not essential for blood stage development and the formation of oocysts and salivary gland sporozoites. Sporozoites show however a strongly reduced infectivity.
Evidence is presented that in the absence of IK2, eIF2α is not phosphorylated in the mutant sporozoites and protein synthesis is enhanced.
Evidence is presented that IK2 activity leads to inhibition of translation in salivary gland sporozoites and accumulation of 'stalled' mRNAs into granules
Evidence is presented that mutant salivary gland sporozoites prematurely develop into liver stages, indicating that sporozoite 'latency' (arrested development in salivary glands) is controlled by IK2.

See RMgm-532 for an  independent P. berghei mutant lacking expression of IK2 (PBANKA_020580). Phenotype analyses of this mutant showed the following characteristics: Ookinete numbers (in vitro) reduced to 52% of wild type; Oocyst numbers (day 12-14) reduced to 20% of wild type; Sporozoites NOT different from wild type; Transmitted by mosquito bite.

See below for a picture showing the location of the target regions used to disrupt PBANKA_020580 in the mutant described here and for mutant RMgm-532

Additional information
The phenotype is based on the analysis of mutants obtained from a single transfection experiment.

In this study also the P. falciparum orthologous gene PfeIK2 (PfA0380w) was disrupted by single-crossover homologous recombination. Clones of PfeIK2(-) completed the sexual development in mosquitoes and sporozoites invaded the salivary glands in numbers similar to wild-type.

Evidence is presented that in wild type parasites 'stalled' mRNAs accumulate in RNA granules whereas in the absence of IK2, RNA granules and and levels of bulk poly(A) RNA were strongly decreased in the mutant sporozoites.

The analysis of the morphology of mutant sporozoites by light- and transmission electron microscopy provided evidence for premature development of salivary gland sporozoites into liver stages (as shown by the formation of 'bulbs' and IMC (inner membrane complex) disruption in sporozoites.

See RMgm-483 for negative attempts to disrupt protein kinase PK4 (PFF1370w; PBANKA_112690) in P. berghei , indicating an essential role of PK4 during asexual blood stage development.

Evidence has been presented that P. falciparum IK1 (PF14_0423; eukaryotic initiation factor 2alpha kinase 1) is not required for P. falciparum asexual and sexual blood stage development and sporozoite formation (Fenell C et al. 2009. Malar J. 8, 99). Evidence is provided that PfeIK1, is able to phosphorylate the P. falciparum eIF2α orthologue (PF07_0117) in vitro and that eIF2α phosphorylation in response to starvation is abolished in asexual parasites lacking expression of IK1.

Disruption of the P. falciparum ortholog has been attempted (Solyakov et al., 2011, Nat Commun, 2:565). After transfection with a KO vector a strong PCR signal diagnostic for gene disruption was observed in transfected populations indicating that this gene is not essential for asexual proliferation. Cloning will however be required to validate this interpretation for this

Other mutants
RMgm-483 - negative attempts to disrupt protein kinase PK4 (PFF1370w; PBANKA_112690) in P. berghei
RMgm-532 - An  independent P. berghei mutant lacking expression of IK2 (PBANKA_020580)


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0205800
Gene Model P. falciparum ortholog PF3D7_0107600
Gene productserine/threonine protein kinase, putative
Gene product: Alternative nameIK2; UIS1, up-regulated in infective sporozoites 1
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption According to the (new) P. berghei assembly and annotation from GeneDB, only part of the gene was disrupted. Of the 8174bp CDS, a 5' fragment of 4367bp remains intact.

The previous systematic id comprised 4 gene models: PB108190.00.0, PB102277.00.0, PB001255.02.0 and PB105212.00.0. Here, the disruption would result in a partial knock-out of PB102277.00.0 and complete knock-out of PB001255.02.0.
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationPbeIK2 was replaced by double-crossover homologous recombination by the hDHFR selectable marker and a constitutively expressed GFP cassette
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CATTATATGGAAACAAAATACTTGTTAAAC
Additional information primer 1PbeIK2rep5for
Sequence Primer 2ATTCGGTTCAACGTTGGTTAC
Additional information primer 2PbeIk2rep5rev
Sequence Primer 3TAGTCTTATCACAAATAATGGATATAT
Additional information primer 3PbeIK2rep3for
Sequence Primer 4AAGTGAATAATAATAATATATATTATTAGTAC
Additional information primer 4PbeIK2rep3rev
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6