Summary

RMgm-402
Malaria parasiteP. berghei
Genotype
Other modificationGene model (rodent): PBANKA_1318000; Gene model (P.falciparum): PF3D7_1454300; Gene product: SNF1-related serine/threonine protein kinase KIN
Details modification: Transposase mediated piggyBac insertion into the ORF
PhenotypeNo phenotype has been described
Last modified: 23 March 2011, 15:23
  *RMgm-402
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Other
Reference (PubMed-PMID number) Reference 1 (PMID number) : 21418605
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone P. berghei ANKA cl15cy1
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherJ. Fonager; C.J. Janse; A.P. Waters
Name Group/DepartmentLeiden Malara Research Group
Name InstituteLeiden University Medical Center
CityLeiden
CountryThe Netherlands
Name of the mutant parasite
RMgm numberRMgm-402
Principal namepiggyBac P5 (5)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationNo
Phenotype
Asexual blood stageNot tested
Gametocyte/GameteNot tested
Fertilization and ookineteNot tested
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation

A transposase mediated piggyBac insertion into the open reading frame (ORF).

PiggyBac insertion into the TTAA tetranucleotide insertion site

acgtaataattttttcttatttaatatttttattgcaactattt

The piggyBac insert was identified using a TAIL PCR approach. The piggyBac insertion is expected to affect/disrupt expression of the gene. The presence of an insert in the ORF may therefore provide indirect evidence that the gene is NOT essential for blood stage development. However, neither expression or the phenotype of the mutant containing the insert have been analysed.

See RMgm-521 for an independent mutant lacking expression of PBANKA_131800. This mutant has been generated by standard methods of gene disruption. Phenotype analyses indicate normal blood stage development.  The mutant shows a strongly reduced sporozoite production.

PiggyBac-mediated insertion was achieved when parasites containing the transposase gene stably integrated into the genome (see RMgm-406) were transfected with piggyBac donor plasmids.

In the paper describing this mutant two different approaches were used to obtain insertion of piggyBac elements into the genome of P. berghei. In the first approach parasites were ‘co-transfected’ with both piggyBac donor plasmid (pL1302) and the helper plasmid (pL1301). The helper plasmid contains the transposase under the control of the constitutive eef1a promoter and this plasmid does not contain a drug-selection cassette (see Figure). Since plasmids are not retained in parasites during asexual growth without drug-selection the helper plasmid is ‘transiently transfected’ and will be lost from the parasites during blood stage growth. In the second approach the donor plasmid was transfected into transgenic parasites that contained the transposase gene stably integrated into the c/d-ssu-rrna gene locus.  This transgenic line, TPSama1 (RMgm-406), was generated using standard methods for transfection of P. berghei and the transgenic parasites contain the T. gondii dhfr/ts as a selectable marker and transposase under the control of the schizont specific ama-1 promoter (see Figure).
The donor plasmid contains the 5’and 3’ inverted terminal repeats of the piggyBac element. which are the minimal cis elements necessary for piggyBac mobilization. Both inverted repeat sequences consist of a terminal 13 bp and internal 19 bp perfect inverted repeat that are separated by a 3 bp (5′ITR) or a 31 bp (3′ITR) spacer. In the donor plasmid the two ITR sequences are located on both sides of a drug-selectable marker cassette and a gfp expression cassette that lacks a promoter region (see Figure). The target site for piggyBac insertion is TTAA and it moves by precise insertion and excision mechanisms. Transfection of the donor plasmid would therefore result in insertion of both the drug-selectable marker cassette and the gfp-expression site without leaving a footprint at an insertion site. Insertion of the drug selectable marker, the human dhfr gene, allows for selection of parasites containing the inserts using pyrimethamine or WR99210.


  Other: Mutant parasite with another genetic modification
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1318000
Gene Model P. falciparum ortholog PF3D7_1454300
Gene productSNF1-related serine/threonine protein kinase KIN
Gene product: Alternative name
Description
Short description of the modificationTransposase mediated piggyBac insertion into the ORF
DescriptionSee Additional Remarks Phenotype