RMgmDB - Rodent Malaria genetically modified Parasites

Back to search results

Summary

RMgm-400

Malaria parasite	P. berghei
Genotype
Mutated	Gene model (rodent): PBANKA_0905900; Gene model (P.falciparum): PF3D7_1143100; Gene product: AP2 domain transcription factor AP2-O, putative (AP2-O, AP2 in ookinetes; ApiAP2) Details mutation: The AP2 domain of AP2-O swapped with that of AP2-Sp (PBANKA_132980)
Phenotype	Fertilization and ookinete;

Last modified: 14 June 2010, 19:39

*RMgm-400

Successful modification	The parasite was generated by the genetic modification
The mutant contains the following genetic modification(s)	Gene mutation
Reference (PubMed-PMID number)	Reference 1 (PMID number) : 20025671
MR4 number
top of page
Parent parasite used to introduce the genetic modification
Rodent Malaria Parasite	P. berghei
Parent strain/line	P. berghei ANKA
Name parent line/clone	Not applicable
Other information parent line
top of page
The mutant parasite was generated by
Name PI/Researcher	M. Yuda; I. Kaneko
Name Group/Department	Department of Medical Zoology
Name Institute	Mie University School of Medicine
City	Mie
Country	Japan
top of page
Name of the mutant parasite
RMgm number	RMgm-400
Principal name	AP2-O::Sp
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modification	Yes
top of page
Phenotype
Asexual blood stage	Not different from wild type
Gametocyte/Gamete	Not different from wild type
Fertilization and ookinete	Evidence is presented that in the ookinete stage of the mutant parasite several target genes of the transcription factor AP2-Sp are expressed. In wild type parasites these genes are expressed in the oocyst/sporozoite stage.
Oocyst	Not tested
Sporozoite	Not tested
Liver stage	Not tested
Additional remarks phenotype	Mutant/mutation The mutant expresses a mutated form of AP2-O whose AP2 domain had been swapped with that of AP2-Sp (AP2 in sporozoites; PBANKA_132980;PF14_0633). Protein (function) AP2-O belongs to the Apetala2 (AP2) family which encode transcription factors (TFs). The AP2 family TFs were first identified in plants. Plant AP2 family TFs are named for their possession of at least one common DNA-binding domain of approximately 60 amino acids, the AP2 domain. Bioinformatic analyses have revealed the presence of 26 AP2-related genes in the Plasmodium genome. The predicted Plasmodium AP2-related genes encode proteins with one to four AP2 domains. AP2-O has two conserved regions which include the single AP2 domain near the C-terminus. Evidence has been presented that AP2-O is a transcription factor that binds to promoter regions of genes and activates expression of genes that are expressed during ookinete development , including genes involved in mosquito midgut invasion (see also RMgm-207, RMgm-208). AP2-Sp contains a single AP2 domain. Evidence has been presented that AP2-Sp is a transcription factor that binds to promoter regions of genes that are expressed during sporozoite formation and play a role in sporozoite infectivity and regulates expression of these genes (see also RMgm-398, RMgm-399). Phenotype Evidence is presented that in the ookinete stage of the mutant parasite several target genes of AP2-Sp are expressed. In wild type parasites these genes are expressed in the oocyst/sporozoite stage. Additional information Phenotype analyses of a P. berghei mutant lacking expression of AP2-Sp (RMgm-399) indicate an essential role of AP2-Sp for sporozoite formation and indicate that AP2-Sp is a transcription factor that binds to promoter regions of genes that are expressed during sporozoite development and activates expression of genes, including genes involved in sporozoite infectivity. The chimeric AP2-O::Sp protein induces in the ookinete stage expression of several target genes of AP2-Sp that are normally expressed in the oocyst/sporozoite stage. ChIP-qPCR assays provided evidence that the chimeric AP2-O::Sp protein activated these genes by directly binding to their promoter regions. This indicates that AP2-Sp is the trans-factor that interacts with the cis-elements. Other mutants RMgm-399: a mutant lacking expression of AP2-Sp (AP2 in sporozoites; PBANKA_132980;PF14_0633) RMgm-398: a mutant expressing a GFP-tagged form of AP2-Sp (PBANKA_132980;PF14_0633) RMgm-207: a mutant lacking expression of AP2-O (AP2 in ookinetes: PBANKA_090590; PF11_0442) RMgm-208: a mutant expressing a GFP-tagged form of AP2-O (AP2 in ookinetes; PBANKA_090590; PF11_0442)

Mutated: Mutant parasite with a mutated gene

top of page

Details of the target gene

Gene Model of Rodent Parasite

PBANKA_0905900

Gene Model P. falciparum ortholog

PF3D7_1143100

Gene product

AP2 domain transcription factor AP2-O, putative

Gene product: Alternative name

AP2-O, AP2 in ookinetes; ApiAP2

top of page

Details of the genetic modification

Short description of the mutation

The AP2 domain of AP2-O swapped with that of AP2-Sp (PBANKA_132980)

Inducable system used

Short description of the conditional mutagenesis

Not available

Additional remarks inducable system

Type of plasmid/construct

Plasmid double cross-over

PlasmoGEM (Sanger) construct/vector used

Modified PlasmoGEM construct/vector used

Plasmid/construct map

Plasmid/construct sequence

Restriction sites to linearize plasmid

XhoI, NotI

Selectable marker used to select the mutant parasite

hdhfr

Promoter of the selectable marker

Hsp70

Selection (positive) procedure

pyrimethamine

Selection (negative) procedure

Additional remarks genetic modification

The targeted insertion construct for AP2-O::Sp parasites was prepared as follows. Part of the AP2-O coding region, just upstream of the AP2 domain, was amplified by PCR and ligated in frame to a DNA fragment encoding the AP2 domain of AP2-SP. This fragment was inserted into the XhoI/BglII site of the targeted insertion construct for AP2-O::GFP (RMgm-208) in place of the 3′ part of the AP2-Sp coding region and the GFP gene.

Additional remarks selection procedure

Primer information: Primers used for amplification of the target sequences Click to view information

Primer information: Primers used for amplification of the target sequences Click to hide information

Sequence Primer 1	AAACTCGAGAATACAGCACAGAAGTGTAC
Additional information primer 1	AP2-O coding region
Sequence Primer 2	TGTGGTGGTGGTGCTACTTCTGTATTTTTATTTATTACATTGTTCG
Additional information primer 2	AP2-O coding region
Sequence Primer 3	GAAGTAGCACCACCACCACAAG
Additional information primer 3	coding region of the AP2 domain of AP2-SP
Sequence Primer 4	AAAGCTAGCATTATTTGAATGATCTAGACTTGGGCATCC
Additional information primer 4	coding region of the AP2 domain of AP2-SP
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6

top of page