Summary

RMgm-400
Malaria parasiteP. berghei
Genotype
MutatedGene model (rodent): PBANKA_0905900; Gene model (P.falciparum): PF3D7_1143100; Gene product: AP2 domain transcription factor AP2-O, putative (AP2-O, AP2 in ookinetes; ApiAP2)
Details mutation: The AP2 domain of AP2-O swapped with that of AP2-Sp (PBANKA_132980)
Phenotype Fertilization and ookinete;
Last modified: 14 June 2010, 19:39
  *RMgm-400
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene mutation
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20025671
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherM. Yuda; I. Kaneko
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University School of Medicine
CityMie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-400
Principal nameAP2-O::Sp
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteEvidence is presented that in the ookinete stage of the mutant parasite several target genes of the transcription factor AP2-Sp are expressed. In wild type parasites these genes are expressed in the oocyst/sporozoite stage.
OocystNot tested
SporozoiteNot tested
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a mutated form of AP2-O whose AP2 domain had been swapped with that of AP2-Sp (AP2 in sporozoites; PBANKA_132980;PF14_0633).

Protein (function)
AP2-O belongs to the Apetala2 (AP2) family which encode transcription factors (TFs). The AP2 family TFs were first identified in plants. Plant AP2 family TFs are named for their possession of at least one common DNA-binding domain of approximately 60 amino acids, the AP2 domain. Bioinformatic analyses have revealed the presence of 26 AP2-related genes in the Plasmodium genome. The predicted Plasmodium AP2-related genes encode proteins with one to four AP2 domains.

AP2-O has two conserved regions which include the single AP2 domain near the C-terminus. Evidence has been presented that AP2-O is a transcription factor that binds to promoter regions of genes and activates expression of genes that are expressed during ookinete development , including genes involved in mosquito midgut invasion (see also RMgm-207, RMgm-208).

AP2-Sp contains a single AP2 domain. Evidence has been presented that AP2-Sp is a transcription factor that binds to promoter regions of genes that are expressed during sporozoite formation and play a role in sporozoite infectivity and regulates expression of these genes (see also RMgm-398, RMgm-399).

Phenotype
Evidence is presented that in the ookinete stage of the mutant parasite several target genes of AP2-Sp are expressed. In wild type parasites these genes are expressed in the oocyst/sporozoite stage.

Additional information
Phenotype analyses of a P. berghei mutant lacking expression of AP2-Sp (RMgm-399) indicate an essential role of AP2-Sp for sporozoite formation and indicate that  AP2-Sp is a transcription factor that binds to promoter regions of genes that are expressed during sporozoite development and activates expression of genes, including genes involved in sporozoite infectivity.

The chimeric AP2-O::Sp protein induces in the ookinete stage expression of several target genes of AP2-Sp that are normally expressed in the oocyst/sporozoite stage.
ChIP-qPCR assays provided evidence that the chimeric AP2-O::Sp protein activated these genes by directly binding to their promoter regions. This indicates that AP2-Sp is the trans-factor that interacts with the cis-elements.

Other mutants
RMgm-399: a mutant lacking expression of AP2-Sp (AP2 in sporozoites; PBANKA_132980;PF14_0633)
RMgm-398: a mutant expressing a GFP-tagged form of AP2-Sp (PBANKA_132980;PF14_0633)
RMgm-207: a mutant lacking expression of AP2-O (AP2 in ookinetes: PBANKA_090590; PF11_0442)
RMgm-208: a mutant expressing a GFP-tagged form of AP2-O (AP2 in ookinetes; PBANKA_090590; PF11_0442)
 


  Mutated: Mutant parasite with a mutated gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_0905900
Gene Model P. falciparum ortholog PF3D7_1143100
Gene productAP2 domain transcription factor AP2-O, putative
Gene product: Alternative nameAP2-O, AP2 in ookinetes; ApiAP2
Details of the genetic modification
Short description of the mutationThe AP2 domain of AP2-O swapped with that of AP2-Sp (PBANKA_132980)
Inducable system usedNo
Short description of the conditional mutagenesisNot available
Additional remarks inducable system
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid XhoI, NotI
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerHsp70
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationThe targeted insertion construct for AP2-O::Sp parasites was prepared as follows. Part of the AP2-O coding region, just upstream of the AP2 domain, was amplified by PCR and ligated in frame to a DNA fragment encoding the AP2 domain of AP2-SP. This fragment was inserted into the XhoI/BglII site of the targeted insertion construct for AP2-O::GFP (RMgm-208) in place of the 3′ part of the AP2-Sp coding region and the GFP gene.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAACTCGAGAATACAGCACAGAAGTGTAC
Additional information primer 1AP2-O coding region
Sequence Primer 2TGTGGTGGTGGTGCTACTTCTGTATTTTTATTTATTACATTGTTCG
Additional information primer 2AP2-O coding region
Sequence Primer 3GAAGTAGCACCACCACCACAAG
Additional information primer 3coding region of the AP2 domain of AP2-SP
Sequence Primer 4AAAGCTAGCATTATTTGAATGATCTAGACTTGGGCATCC
Additional information primer 4coding region of the AP2 domain of AP2-SP
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6