Summary

RMgm-399
Malaria parasiteP. berghei
Genotype
DisruptedGene model (rodent): PBANKA_1329800; Gene model (P.falciparum): PF3D7_1466400; Gene product: AP2 domain transcription factor AP2-SP (Apetala2; AP2-Sp; AP2 in sporozoites; ApiAP2)
Phenotype Oocyst; Sporozoite;
Last modified: 14 June 2010, 11:22
  *RMgm-399
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene disruption
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20025671
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherM. Yuda; I. Kaneko
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University School of Medicine
CityMie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-399
Principal nameAP2-Sp(-)
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystNormal numbers of oocysts are formed. However, no sporozoites were formed inside these oocysts.
SporozoiteNo sporozoites are formed inside the oocysts.
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant lacks expression of  a transcription factor with AP2 domain(s) (AP2-Sp, AP2 in sporozoites)

Protein (function)
AP2-Sp belongs to the Apetala2 (AP2) family of genes which encode transcription factors (TFs). The AP2 family TFs were first identified in plants. Plant AP2 family TFs are named for their possession of at least one common DNA-binding domain of approximately 60 amino acids, the AP2 domain. Bioinformatic analyses have revealed the presence of 26 AP2-related genes in the Plasmodium genome. The predicted Plasmodium AP2-related genes encode proteins with one to four AP2 domains. AP2-Sp contains a single AP2 domain.

Phenotype
The phenotype analyses indicate an essential role of AP2-sp during sporozoite development. The phenotype analyses as described in 'Additional information' indicate that AP2-Sp is a transcription factor that binds to promoter regions of genes that are expressed during sporozoite formation and play a role in sporozoite infectivity and regulates expression of these genes.

Additional information
Nuclear staining of oocysts with Hoechst showed that the nucleus of each oocyst was divided into several small nuclei 10 days after the infective blood meal in mutant and in wild-type parasites. Semithin sections stained with Giemsa, however, revealed that the subsequent invagination of the plasma membrane, which is necessary for formation of sporoblasts, did not occur in mutant oocysts.

A transgenic P. berghei mutant was generated that expresses a GFP-tagged form of AP2-Sp (RMgm-398). Analyses of this mutant show expression of AP2-Sp in oocysts and sporozoites.

Evidence has been presented that the P. falciparum ortholog (PF14_0633) of P. berghei AP2-Sp is (also) transcribed in asexual blood stages (de Silva et al., PNAS, 2008, 105, 8393-8; Bozdech Z et al., 2003, PloS Biol. 1: E5).

Electrophoretic mobility-shift assay showed that the DNAbinding domain of AP2-Sp recognizes specific eight base sequences, beginning with TGCATG, which are present in the proximal promoter region of all known sporozoite-specific genes. Promoter assays demonstrated that these sequences act as cis-acting elements and are critical for the expression of sporozoite-specific genes with different expression profiles.

A transgenic parasite mutant was generated (RMgm-400) that express endogenous AP2-O (APETALA2 in ookinetes; PBANKA_090590; PF11_0442), but whose AP2 domain had been swapped with that of AP2-Sp. It is shown that in this mutant expression of several target genes of AP2-Sp were induced in the ookinete stage.

Other mutants
RMgm-398: a mutant expressing a GFP-tagged form of AP2-Sp (AP2 in sporozoites)
RMgm-400: a mutant expressing a mutated form of AP2-O (PBANKA_090590; PF11_0442)whose AP2 domain had been swapped with that of AP2-Sp
RMgm-207: a mutant lacking expression of AP2-O (AP2 in ookinetes: PBANKA_090590; PF11_0442)
RMgm-208: a mutant expressing a GFP-tagged form of AP2-O (AP2 in ookinetes; PBANKA_090590; PF11_0442)
 


  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1329800
Gene Model P. falciparum ortholog PF3D7_1466400
Gene productAP2 domain transcription factor AP2-SP
Gene product: Alternative nameApetala2; AP2-Sp; AP2 in sporozoites; ApiAP2
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the genePartial
Additional remarks partial/complete disruption The hdhfr selectable marker gene was integrated into the AP2-Sp locus, replacing a relative small part of the coding sequence
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerELF-a
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modificationTwo fragments of the AP2-Sp gene were amplified by PCR. The fragments were annealed to either side of the selectable marker gene (human DHFR) by PCR with primers 1 and 4.
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CGAATAGGTGTTTTTGAATATTATGTTC
Additional information primer 1Primer 1
Sequence Primer 2CTCATCTACAAGCATCGTCGACAACGTTTGATGCGGTGC
Additional information primer 2Primer 2
Sequence Primer 3CCTTCAATTTCGGATCCACTAGTGCATCTTCTCAAAATAC
Additional information primer 3Primer 3
Sequence Primer 4CATTAAGGTATTGAGATAAATTGTTGTG
Additional information primer 4Primer 4
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6