Summary

RMgm-398
Malaria parasiteP. berghei
Genotype
TaggedGene model (rodent): PBANKA_1329800; Gene model (P.falciparum): PF3D7_1466400; Gene product: AP2 domain transcription factor AP2-SP (Apetala2; AP2-Sp, AP2 in sporozoites; ApiAP2)
Name tag: GFP
Phenotype Oocyst; Sporozoite;
Last modified: 14 June 2010, 10:34
  *RMgm-398
Successful modificationThe parasite was generated by the genetic modification
The mutant contains the following genetic modification(s) Gene tagging
Reference (PubMed-PMID number) Reference 1 (PMID number) : 20025671
MR4 number
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
The mutant parasite was generated by
Name PI/ResearcherM. Yuda; I. Kaneko
Name Group/DepartmentDepartment of Medical Zoology
Name InstituteMie University School of Medicine
CityMie
CountryJapan
Name of the mutant parasite
RMgm numberRMgm-398
Principal nameAP2-Sp::GFP
Alternative name
Standardized name
Is the mutant parasite cloned after genetic modificationYes
Phenotype
Asexual blood stageNot different from wild type
Gametocyte/GameteNot different from wild type
Fertilization and ookineteNot different from wild type
OocystGFP-expression in a few oocysts 6 days after the infectious blood meal. Day 10 oocysts showed strong GFP-expression. Fluorescence signals were localized to the nuclei of sporozoites budding from sporoblasts (see also 'Additional remarks phenotype').
SporozoiteGFP-expression in both oocyst-derived and salivary gland sporozoites. Fluorescence signals were localized to the nuclei of sporozoites (see also 'Additional remarks phenotype').
Liver stageNot tested
Additional remarks phenotype

Mutant/mutation
The mutant expresses a GFP-tagged (C-terminal) version of AP2-Sp (transcription factor with AP2 domains).

Protein (function)
AP2-Sp belongs to the Apetala2 (AP2) family of genes which encode transcription factors (TFs). The AP2 family TFs were first identified in plants. Plant AP2 family TFs are named for their possession of at least one common DNA-binding domain of approximately 60 amino acids, the AP2 domain. Bioinformatic analyses have revealed the presence of 26 AP2-related genes in the Plasmodium genome. The predicted Plasmodium AP2-related genes encode proteins with one to four AP2 domains. AP2-Sp contains a single AP2 domain. See also mutant RMgm-399 lacking expression of AP2-Sp. Phenotype analyses of this mutant indicate an essential role of AP2-Sp for sporozoite formation and indicate that  AP2-Sp is a transcription factor that binds to promoter regions of genes that are expressed during sporozoite development and activates expression of genes, including genes involved in sporozoite infectivity.

Phenotype
GFP fluorescence was observed in some oocysts 6 days after the infective blood meal The proportion of GFP-positive oocysts increased with time. In these oocysts signals were weak and localized in Hoechst-stained spotted nuclei of the sporoblasts. In day 10 oocysts (new) strong GFP signals appeared in oocysts. These signals were localized to the nuclei of sporozoites budding from sporoblasts and displayed ringlike appearances around the core of the sporoblasts. GFP-expression in both oocyst-derived and salivary gland sporozoites. Fluorescence signals were localized to the nuclei of sporozoites.

Additional information
Evidence has been presented that the P. falciparum ortholog (PF14_0633) of P. berghei AP2-Sp is (also) transcribed in asexual blood stages (de Silva et al., PNAS, 2008, 105, 8393-8; Bozdech Z et al., 2003, PloS Biol. 1: E5).

Phenotype analyses of a P. berghei mutant lacking expression of AP2-Sp (RMgm-399) indicate an essential role of AP2-Sp for sporozoite formation and indicate that  AP2-Sp is a transcription factor that binds to promoter regions of genes that are expressed during sporozoite development and activates expression of genes, including genes involved in sporozoite infectivity.

A transgenic parasite mutant was generated (RMgm-400) that express endogenous AP2-O (APETALA2 in ookinetes; PBANKA_090590; PF11_0442), but whose AP2 domain had been swapped with that of AP2-Sp. It is shown that in this mutant expression of several target genes of AP2-Sp were induced in the ookinete stage.

Other mutants
RMgm-399: a mutant lacking expression of AP2-Sp (AP2 in sporozoites)
RMgm-400: a mutant expressing a mutated form of AP2-O (PBANKA_090590; PF11_0442)whose AP2 domain had been swapped with that of AP2-Sp
RMgm-207: a mutant lacking expression of AP2-O (AP2 in ookinetes: PBANKA_090590; PF11_0442)
RMgm-208: a mutant expressing a GFP-tagged form of AP2-O (AP2 in ookinetes; PBANKA_090590; PF11_0442)
 


  Tagged: Mutant parasite with a tagged gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1329800
Gene Model P. falciparum ortholog PF3D7_1466400
Gene productAP2 domain transcription factor AP2-SP
Gene product: Alternative nameApetala2; AP2-Sp, AP2 in sporozoites; ApiAP2
Details of the genetic modification
Name of the tagGFP
Details of taggingC-terminal
Additional remarks: taggingTo construct AP2-Sp::GFP parasites, the targeting vector containing a marker gene, human DHFR (hDHFR), was integrated into the AP2-Sp locus by double-cross-over recombination, adding the GFP gene to the C-terminal portion of AP2-Sp and conferring pyrimethamine resistance to the AP2-Sp::GFP parasites
Commercial source of tag-antibodies
Type of plasmid/constructPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid XhoI, NotI
Selectable marker used to select the mutant parasitehdhfr
Promoter of the selectable markerHsp70
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedure
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1AAACTCGAGCCAGTGACATATGTGATCTTAATG
Additional information primer 1Targeted insertion construct (the 3′ part of the AP2-Sp coding region); Forward (XhoI)
Sequence Primer 2AAAGCTAGCATACTGTGGAGATATATTACTCATTCC
Additional information primer 2Targeted insertion construct (the 3′ part of the AP2-Sp coding region); Reverse (NheI)
Sequence Primer 3AAAGGATCCATGATAGTGATAATGACAGAGT
Additional information primer 3Targeted insertion construct (the downstream region of the AP2-Sp gene); Forward (BamHI)
Sequence Primer 4AAAGCGGCCGCAAAAAGCATACCACAATCACC
Additional information primer 4Targeted insertion construct (the downstream region of the AP2-Sp gene); Reverse (NotI)
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6