Summary

RMgm-297
Malaria parasiteP. berghei
Genotype
Genetic modification not successful
DisruptedGene model (rodent): PBANKA_1008500; Gene model (P.falciparum): PF3D7_1436300; Gene product: translocon component PTEX150 (PTEX150, Plasmodium translocon of exported proteins)
PhenotypeNo phenotype has been described
Last modified: 24 August 2009, 21:57
  *RMgm-297
Successful modificationThe gene/parasite could not be changed/generated by the genetic modification.
The following genetic modifications were attempted Gene disruption
Number of attempts to introduce the genetic modification 2
Reference (PubMed-PMID number) Reference 1 (PMID number) : 19536257
Parent parasite used to introduce the genetic modification
Rodent Malaria ParasiteP. berghei
Parent strain/lineP. berghei ANKA
Name parent line/clone Not applicable
Other information parent line
Attempts to generate the mutant parasite were performed by
Name PI/ResearcherT. F. de Koning-Ward, B.S. Crabb
Name Group/DepartmentThe Walter &Eliza Hall Institute of Medical Research
Name InstituteThe Walter &Eliza Hall Institute of Medical Research
CityMelbourne
CountryAustralia

  Disrupted: Mutant parasite with a disrupted gene
Details of the target gene
Gene Model of Rodent Parasite PBANKA_1008500
Gene Model P. falciparum ortholog PF3D7_1436300
Gene producttranslocon component PTEX150
Gene product: Alternative namePTEX150, Plasmodium translocon of exported proteins
Details of the genetic modification
Inducable system usedNo
Additional remarks inducable system
Type of plasmid/construct usedPlasmid double cross-over
PlasmoGEM (Sanger) construct/vector usedNo
Modified PlasmoGEM construct/vector usedNo
Plasmid/construct map
Plasmid/construct sequence
Restriction sites to linearize plasmid
Partial or complete disruption of the geneComplete
Additional remarks partial/complete disruption
Selectable marker used to select the mutant parasitetgdhfr
Promoter of the selectable markerpbdhfr
Selection (positive) procedurepyrimethamine
Selection (negative) procedureNo
Additional remarks genetic modification
Additional remarks selection procedureIn the paper it is reported that repeated attempts to generate gene knockouts in P. falciparum and P. berghei were unsuccessful. In the paper no details are provided on the constructs used to disrupt PTEX150. Information on the constructs to disrupt P. berghei PTEX150 provided here in the RMgm database are obtained from Dr. T.F. de Koning-Ward (The Walter &Eliza Hall Institute of Medical Research, Melbourne, Australia).

PTEX150 (Plasmodium translocon of exported proteins protein 150) is a protein with a putative ER signal, is expressed in blood stages; it has an apical location in merozoites and a parasitophorous vacuole membrane (PVM) localisation in ring forms and trophozoites. Evidence is presented that PTEX150 forms a complex with HSP101 (PF11_0175) and several other proteins in the PVM and functions as an protein trafficking apparatus (translocon) located in the vacuole membrane and involved in transport of proteins from the parasitophorous vacuole into the cytosol of the erythrocyte.
Primer information: Primers used for amplification of the target sequences  Click to view information
Primer information: Primers used for amplification of the target sequences  Click to hide information
Sequence Primer 1CGGGGTACC CTCTGTTGATGTTATAGATTGTCCAG
Additional information primer 1F1F
Sequence Primer 2CCGAAGCTT CACCATTCGATAATTTGTCAAAAGAC
Additional information primer 2F1R
Sequence Primer 3TCCGATATC CCGATGAGCTTGGAAATGGAAATACAG
Additional information primer 3F2F
Sequence Primer 4CGCGGATCC AAATGCGCCTATAAAGCATACGTATA
Additional information primer 4F2R
Sequence Primer 5
Additional information primer 5
Sequence Primer 6
Additional information primer 6